Description :
From Genome Similarity Track
Location :
scaffold_2:1090387- 1103120
Transcript NameFunction/comments
Plaha_PHALS_0674460s ribosomal protein
Plaha_PHALS_06745copper-translocating p-type atpase
Plaha_PHALS_06746Uridylate kinase/adenylate kinase
Plaha_PHALS_06747hypothetical protein PHYSODRAFT_467823
Plaha_PHALS_06748serine threonine protein kinase

Sequence
12733 bases(100 bases per row)
ATTACTTCAGCAAGTATATATGTTCTTTCAGTCTTTTAGCCATTACACATTATGCCGCTATAACATTTTGCTaaagcaaattttaaaaCTTCAAGGTGTG
GACGCGGTCATTCTTGGTCAACGAGAATTTAGCGTTCAAGTAGGCCTTAAGGAACGGCTCAGCATCAAGCTTTTTCAGCAGAACCGAGTCCACAGCCTTC
TGGTCCTGCTTGCGCTGCTCTGGGATGACGGGAGCCTAAAACGAAAAATAACAGCAACATAGTCAGCGTCTAATAGGGAGCTTATGTGCCGAAGCAAGCG
ATCCCAAGCGCTCAAAGGACGTGGTAGGTGTCTTATAAAACATTATTCCTCTCAATCCGTCATGCTATAAAGAACCAAATTTGTTCAATACCCTCAGCCT
CCAATGCATGACAATCACACATTGTAGAAAGACCGTGTAGTAGGTATTTCGAAATTGACCAACCGAAATGGGACGCTCACATGGGCCGTAGATATAGATA
AAAGCCAAAGACTTACCGCGCTTGACTGTGCAAAAAACTGATCCTCTTTGTTCTTCTTGGCAGCTTTCTCCTTGGCAAAGTAGGCGTCATCGATGGCTGG
AAGATTCAGCCCCTCGATATTTACCTTTGTCGAAGTAGCAATCACGTAAGACTGGTTCACACGACGAATGGGTACGCCGTTGACTTTGTACGGACCTGAA
TTAATCCATCAATTACACAGCGTCAGTTCGCCTAGAACGAGTTGATGCTATACTGCCCTGGAGCCATTATCCCTCAGGTCTCATAATCATATAAATCTTT
AGCATGAATTCATCTTTGCTATCCACTGATACTAACAAGTGTCAGGGATCCCAGACTATCCACAACATGAATCTCCTCATTAAAAAGAGACGCAAGTCGC
GAAAAGCCATAAGACTTGGCACACATCAGCACCAATAGATAGGCACGGACGGCGAAATGCTTCTCGCATTGTCAAGTTTGCATCACTGGAATGTTGGCTC
CAGACATTGAAAGATCTTTCTGCTGTAACTTACCAGTAACGAGCAATAGACCTGAAGCCAATTGCTTAAGGAAGACGACACGCTTGCCACGAAAGCGACC
AGTAAGTAGAATTAAAATTGTGCCTGGTGTGATAGACTTTCGCAGCTTCGCAGTCTTTACACTGTTGCGCTTTGTCTTGGCTGACTTAAGTGGCTTAGGG
ATGAAGTCAGCAGGGTACCACTTTCGAGTCGTTGCTTTCTGCTTGGCAACAACCTTCTTTTCGCCACCCTTTTTAACCATCATACCGCGACCATTCTTCT
TTGAGAGGCTATTGCGTGAGATGGCGTTGATGCCACGGGCGAGTACAACGTTAGAAGTCTTGGAAACGGCCATGGTGAAGGATAGAAAAGAACTGAAGGT
GTTCGAGGGCCAACCGTGGCCAACACTATCAGATGGTGTGGCACACAGCACTCTAATACGAATAACGTAACCGGTCAGGGTTAGGAATACTTATTGTTCG
AAGCATCAAACAACAAAATTATCAAACGTTATTACCAGGATGGGTAAGCGCAAGGGTCGTCGTCGAAAAGCCTCATTGAAGTCATACGGATCTGCAAATG
CTGGGCTACCGGATCCTTCGTACGCGCGAAATTGCTGTGATGGTTTCAATAGCGACGAGGGGAAAACTACTGTGTCCGGATCGAGCGGTGACGACGACGA
AGAAGTGATTGATGCGCAGGCTGACGCTATCGATAGTTGTGCAAACAAAGAGAAAATGAAAATGGGCAGCTGCTGCAAAAGAAAGAATGACGAGAAGATG
GATGAAAGCTGCTCTTTCAAAAACAAGTCAAACTGCAACGAGAAGAGAGCTGAAATCATGAAGACTGATGTGAAGGTCGTCCACATATCCACGAATATAG
ACAATTTTTGTGATCAAACTGGTTCGAAGCCATTAAATTGCTGCTCGTCAAAGCAGCGTGCAACTTTAAATGATCCGGATGTATCAGCGATAGACTTTCA
AAAGAAATGTTGTGCGTCGAGAGTGGTCCAGGCATCGAGTAGCCCTTACTGCTACGTATCCAATAGAATAGCTATTAATGCAAATGATCGTAACATTTGT
GAGTCAAACAAAACGACATCATTGTCTAAATGTTGCTCGAAAGCAGCGAGTATTAAGGCCGACGCTGACGATTGTTGTGGAAACCGAAACAAGGTAAAGA
CGTCGAAGCTCTACATGTCTAATTCTCAGACGCCTTCTCTTGGTAATTGCTGCTCATCTCCTCTTATGGCTAATCAAGAGCCCTCAAATTCAGGTTGCTA
CTCAATTGGTGCGCAGGATCTGTCACCTCCTGAGAGATCTTCGAGTTTCTTAGAGCGATTGATGGAGTTTCGTCGTGATCGTGGGGCTTCTCTCGAGAAA
CAAAGGTTCCAGTCTACAAATTTAGGACCAAAGACTAAATCAAATGAGTCACTGGAAGTTCTTCGCTTGAACATTAGTGGAATGACGTGCAATGGCTGCT
GTACGCGCATTGAAAAGTTTATGAGTACTCAGCGAGGAGTCACGGATGTCAATGTGAGTCTGCTTACAAGTCGTGGAGTGTTTTGTTTTGATCCGCAACT
CGTCACGGCAAAAACTATTGAAGACACAGTGGCTTCCTTGGGATTTGAGCCAAGTGTGCTGTCCAGTGACGATCTGGTGAGTGTCATGCTATATTTTGGC
CAACCCGAGAGATCGATACAAGCTCAGAAGCTGGCACTGGCAATCTCCGGTGTCGTTAGAGTAAAAGACGTAAAAAACCAGAAGGCTCTCGGCAAAGCAC
TAATAGTCGAGTACAATCCCGACCTCATAGGTGCTCGACGAATATGTAATTACTTGTCGCAAGAGCTAGGGTCTGCCGTACAAGCATCAACTCCAAGAAC
GCCATCAGTTCGTGCGAGTGCGGAAGAAATGCAACGCATCGCTAAGCACTTGCTCTGGAGCAGCTTGCTGTCGCTACCAGTTATACTCATCGAGTTTGTT
TTGCCGGTCCTTTACCCATCGTCTCGTACTAATCTAGAAGATGTAGGATTTTTTGGCTCTGCAAACCGCTTGAGTATAAAGGATGCGGTGGAATTAGCAT
GCGCGACGCCGGTGCTTTTCCTCATAGCGCGTCCCATTCACGAGAGCGCCTTTTTGGCTCTGCGTTACGGTGGGCGCGTTACCATGGATGTCCTCATTTC
GCTGAGTGCTTGCACAGCGTACGCTTTTTCCATCTTCACTGTTGTTTCTGGTGCGATCGCAAAATCTCAACCACAAGATTCTCAAGCGGATCAACTAACA
AAGTTGCCTGAGCACTCAGCTCAAGACGACTCGCTACGAAAGAATACATTCTTTCAAGTCACTGTGTTCCTGGTTACTCTCATTCTCGTTGGTCGGTTCA
TTGAAACACTAGTCAAAGCTCGTGCATCGAACAGTGTGGATTCATTGCTGCGGATGCAAGCTAAGACAGCCATTTTGCTCGAAGAAGGGGACGAAAAAGA
GTTATACATTGACGTGGCGCTCGTGGAACGTGGTGATCTGCTCAAAGTCCTTCCTGGAACACGCATACCAACGGATGGCGTTGTTGTCAAAGGCGCTTGT
GTTTTGGACGAGTCCATGGTGACGGGTGAAGCTCATAAAGTAGCTAAGGAGCCTGGGGACATCGTCATTGGTGGATCTATTAATTTTCATGGTGTTTTAA
TCATGCAGGTGAGTCATACCATTCATGAATCTATGCTGGCACGCATGGTCCGACTTGTAGGGGAAGCACAGGCCTCTCGTGGTTTGCGCCAGAGCGTTGC
AGATGCCGTGGCTGCTTATTTTACAACATTCATCATTATTCTCGCGGGTCTGATATTCTTAGTGTGGTATTCGCTTGCTATGTACGGTCAAGTTGAAACA
CAAGGGTGGGCGCCTTTTCCGTTTGCACTGCGCTTCGCGATCACAGTGCTAGTCATCAGTTGCCCTTGTGCAATCAGTCTTGCTGTGCCGACAGCAATTA
TGATTGCGACAACTAAAGGTTCTCAAATAGGTATTCTTTTCAAAGGAGGTCGCGCCCTAGAAGCATTTGAAGAAGTTAATGCCGTTGTGTTCGACAAGAC
AGGAACACTCACAAGTGCGCAACTTGAGGTCTCCAGTGTCTTTACACTGCAGACATCTATGACCGAATCACAGCTTTGGAGCTTTGTCGCTGCTGTTGAG
AAGAGCAGTGAACATTCCATTGGTAGAGCTCTTCTAGCACACGCAATAACCCATCTTCAAGGATCACAAGTCGACGAGGCTGAAATATTTGAGGCCATAC
CGGGATGTGGTGTTCACTGTACAGTACGAGGTGTCGATGTGCATCTCGGCTCTCTTGTTTGGCTAAGACAGCAGACGTATGCTGGCTCCCGCACTTTAAA
TGTTCCTCCCGAGTTCATTTTAACAAACAAACGATTCCAGTCTGAAGGCAgcattgtggtctttgttgttgttgacGGTGAATTAGTATCGGCGATCGCA
CTTCGAGATACATTGCGTCCGGAAGCTAAGCGTGTCATCGAACAGGTGAAGCGCTACGGAATTCAACCATGGATTCTGACTGGTGATCAGCGCGGCACGG
CCAAGACTGTGGCGGCGACATTAGGCGTGCCCGAAAGCTCGGTGCTTGCTGAGTGTCTACCGCATCAAAAGGTTGACAAGGTGCGCTTACTTCAAAGTTT
AGGGCTGCGCGTCGCGTTTGTAGGGGATGGTGTGAATGATGCTCCAGCGCTGGCAACAGCAGACGTAggcgttgcacttggtgctGGAACGGATGTAGCG
CTTGACGCTGCAGACGTTGTCTTGGTCAAAGATGATCTTCGCGATTTACTTAATGCTCGAGCGCTTTCAAACGCAACTAACCGACGTATTAAGCACAACT
TTGCGTGGGGATTTATGTACAATCTGCTGATGATGCCGATTGCTTGTGGGGCATTGTATGCTCCTCTCGGGATATGGATTCCTCCAGCTCTCGCTGGATT
GTCAGAACTATTATCGTCCGTGCCGGTGATCCTCTTTTCATTGCTACTTAATCGCTGGAAGCCGCCATTCGGTGGTGACTGGGGACTTAAACAAAATCAC
CTAACAATCGACGTTATCGAGTCGACGCCTCTGCTGTCGAAGCATGGTTGAGTGGAGCTACAAGTTCAGGATggaaaaaaagcaaaatggtTTTCTGATA
TGTTTTATTGAGTTTGGCATGCCGTATTActaatcagcagctgaagccTTTGTGTACTCGAAAAATGCTTCTCTCGCGTGCATTCGGACAGTATGTGGGT
CTGCTGACAAAGCTTTGTCCTCCTCACCAGCCCTGCCATCAACAATAGCGTCGAATCGGTGACGTAGCAGCTCAACATCTTCACAGTCAAAAGAGCCTGA
TAAATGGTTGTCATTTAGTGCGTCCTGCGCAGCACGCACGGTGCGTGCACCCATCGCACCTGAACCACAGGATCGATGTGATGGTGTAGACGCGGCCTTG
AGTTTCTCCCCAAGCCTACAATCGTTCACAAAAGCGTCACGCTTTGCTAAGGCCTTGCGTCGATGCTGTTCAGCTCGCCTTGCTTGTCTTTGCTGATACT
CCTCCTCATATTCTTCTTCATTTTGTGACGCATAACTATTAGGGTCACGTTTTTGCTGATACAATGCCTTGAGTGAAAGGGCAAGATAAACACAAGCCGA
AGCACGTACAGACATTTGCGGAAATTTGGGACGCTCACTTCCCAACGCTAGCAGTACTTCGTTAAGAGTAGCTCCTAGTTCTTGTTCCAGTCGACCCGGA
TAGTTCTTAGCCAATGTGACCTGCGGCGGTAATTTAACTGGCAAGCTTTGCGATATAAATCTTGATGGCTCGACGCAGAATTGGTGGCGTGCTTCTTGTG
AGACAAAGAAATAGACTTTTGAGCGGTACGAAGCGCGGTAAAAGATGCTACCGTGGTGAAGTGCAGACCAATCTTTAGCATCCACGCGCGACCTAAATGT
GACTGGGCAGTAACCTTTCAACTCTGGAAAAATCCAATCTGGTACGGtgagcaagcttataaaGGAAGCGCTGACTGGAGCTTCTGCCACGAGTGCTTGG
GCCACCTTCTCTACTTCTTTGCGCGTTGACCGTAAGGTATCTCCTTCATCCAGCCTTTGATCCGACAAGCACCCGATATATGCCTCAGGACACGCAACAA
ATTGCTCAAGATTTTGTGTGCTTCCCAGCCAATAGgtgaaattttgaaagtcAACACATAGATCTCGATTGGATTGGCACGAGTTAACATATCGCCCCAC
ACGTAGCTCCACCGGACAGAACGTTTGATAGACAGAATGCTGACGAGCTTGTAGCTCTTGATGTGTCCGCACTACACCAATTGAGCGAGCCGCTCGGTTA
CAAGCCAACgcagcggcatgctctgacgCCAATTGTTGCTGCCTCTTGAGAAATTCTTGAGCTTGTGTGACCACATGCCAGAGTGAGCTGTTTGTGGTGT
CCAGTTGCCGAACATGAAAGCCAGTAAAGCGACGAGTCCAGATATCGATAAGCTCCAAGCGGAACGTGTACCATTGTGCAGATGCTTCCTGAAGGGTGCT
CTGGTCCACCTTAGTGTGGCACTCGTTCcacacactcgcaaaagaGCGTTCTAAGACAAACAGCACATcggctttgatactttgcGACACGGCATCAATA
TCACTAGACGTTGGTAGACTGCGCTGCAGCTCGTGAGGATTAAGCTGATACCCGTCAAGAACCCAACCACAAGTCTGGCACTCGGAGGAGTGCAAACGAG
TGCATATAGCTTCATGGATGATGTCAGGACTATAAAGAGGATCGCATTGCTGCTCTTTGATTTCAAGTATTTGAGACCACAATTTGGAACCACACTGACA
CTGAATGACCCAATCGATTGCGTTTTCGGGAGATACGTAAATTGTTTTAAGCGTTTTTGCAAGCTCTCGAGCCACTCGCGTTGTGTCTGAAAAGGGAGTG
CCGACCACGCAACAAGTTGACTGATGTTTTGGTGAGTGGCTTGTTTTTCTTACATATTTGACTGGGCATGCGAGAAAAGCACTATAAGCCTCACGTGATC
GTGGAAAATAGAGTTGGTCCCGGTACACTACTGCTTTGCTGGGTAAAGGCGATGAAGGATCTGTTCGACCAGTCACTGGACAGGCCAAGTCGTGCTTACC
GATAAGAAGCTCTCCCGACGCTAACATTTTAAGTACCTCGTCTCCCATCGGCATGTCAACAACCTGACAACGCTCAAATAGCGCCTCTTGACCTGCCATA
AATTCATTCACTATCGTCTTCACTTGCTTGACCATTTGTCTCATAGTCTGGGTTGCGTCCACTGGATCGCACACTCTGATGCCTCGAGCTCGAAGTTTAG
TAATCGCTTCATCCAAAGCTTCTTGGTCATTGGTGAAACGGTCGTGTAGACGAGAGCTCTCTTCTTCTCTGGCGTCATCCAAATTTATGGAATCGTTTAA
AAATTGGCTAGTATTAACTCCAATACCATCTTTTCGCGTGAAGGCAACATCTTGACGATAGTTGGCAACCCATTGAGTAAGCAAAGTTCGTTCATTTCTT
TCCTCGGACACTATCAAAGGAATGACGAGTGCTGGAAAGAGGCCATGCTTAAAACATTCTTCTAAAACTGTCGGATTTGGGATGCGTGAGTCTTCCGGCC
CTAACCCGGCAGTCACATTTACGATCAAATTGTCATGAGTTGGCATGTGACGTTGTAACTCAAGCTTGAGCGATCGAACAAAATTTATTTCACGCGTTTG
TCGTGCTTCTTCAGGTTTAAGCTCTTCGAGTTGTTGATAGCGTTCGGCACTTTCGACGAGCGCAGTCATGTCCACGTTTATATAGTCGACACTAGAGCAA
CCTCGTTGCGAAAGTGATTGATCTAGAGCTGCAGCAATTCGATTATGACCAGTGCCTCGAACGCCAAGCAGCAGCACCCAAGGAATAAATTTTGAGGTTG
AGAAAGGTTCGTCGAGAATGAATGCTGATGGGTTTCGCTCGAAAGCACGGCGCTCAGTGTCACCAGCAAATGTGTAAAATTTTTGTCGAAAGCAGCAAAT
AGTTGATGGTAGTCCAGGTATCAACAAATTACGTGTATTCCAAGACACTGGACAAAAACGACCACACTCTccctgaagctgcagcgtaACAGTTTTAGCA
TAAGCTTTAATCTGCAATTGTAAGGTTTCGACTTCCGACGCATTTTCAATGTTCTTGTCGTCATCGCTTTCTGAGAATGGTGACGCAAATATCGTGGCCG
GATCGTACCCATCAACAAGTTCGGGCATATGGCCGTCTTTAATTCTATCCAAGCGCGGTGCCAGTGGATTTAGCTCACGATCAATGGCCACTAACGTATC
ACTCGGCTTACGAAACAGAGGGCACGTGATAGATATAGGCTTAAAGTCGAAAACTTGCAAGATTTCGTCAGTAGAAGCCATATCAGTCTGTATTTGGTGA
CGACGTGGCACTACCAAGCCTTCATTTGGTTGAGTGTTTCTGCCTACAtcatcttcttgagctaTAGCCATGTCCTTGTCCAACGTCAAGATCACATCGG
GCACGACATCATGTTCAAGCAAAATAGTAGCAATATCACGAGTTAATGGCAGATCCGTAAGCATCCATCTGTTCGATGTATTAGATGCGGCTACCAATGT
CTTGACGGCTTTTGCGGCTACCGCCGCAGCTTCAATGGACGGAACGATCTGTCCACACGTGAGACGCGTGTCCATTGGAGCCGATGAAATCTCAAGCAAA
TTTAAAGGAGACACTGTCTGTGCATGAAGTCCAGCCCCAAGTTTCTCAGTGTACGATGATTTAACGTTTTCTGTCGTTATGAGCCACATGTTGCGAACTG
TGGATGGAACTGGTACATCCTGACTCAAATACTGCAGTGGGCATGCACAAAAATCACGCCGTGCGTCTTGTGACGACAAAAGATAAACACGACCGGAGTA
ACATGCAGCGAATTCAGGCTCACCATGAGATAGCTTGTTGGTCAAAGTCGATAGCACGGGACAAAATTCACGCCATTTCGATAGCAGTCGGCGATGGGCA
TCACGTCTTGGTAATCGAGCAAAAGAGTTAGCAGCTTCTGCCGCAATAAGCGGATTCCAGTCTCCATATAAAAGCCACTTGACTTGTTCATTGCGGCTAG
AACGTTTTATTTCCTCGGGTAAAGCCACAGAGCAGGCTTCACGTGACGTACTGAAGCGCGATAAACCAAGCAGTGACTAGAAATGACACAAATTAGATAA
ATATTCAAGACAGATAAAAGTACGCACCCCCGTGATTGCTTGaatggaatggtgttggatgACGCCAAACGATTGATTCGCTAGAATAACCACCAAATGA
CAGATCGACCCAATACTTTTTGTCGTTTCTGCTCGGCGTATTGAGAGCTCACGCTGAATACGTTTCAGGTACTTGTGATATCCCAGCCCAACTTTCACCA
TTTTTAAAGTGCCAAAGGGCAACGTATGCTCATTCGATAGCTCAATATCGTTGCCGATTTCAAAATTTAGATCCGGCGGTAGCACCGTTTGTTGTGGTGA
ATCAAAATTAACTGATTGATCGTTCTCCTCTGTAAGGACATCGACTTTATTGCCCTTATTGTCTCTTGCAATTAAACTGTCGATTTCTCCAGCTCCTACC
TTCAACTTTTCTGGTAGCCCGTGAGAATCAGCAAAACTCTGGGTGAGTAGCACGTCACTACTTGTCGCCCTTAAAACCGCTAGCTCCCGAGCTGAGTATA
GACGGCCCGATATAGGTGCCAACTCAGAAGTGTGAAGTTGATATTCCACTTCGCTAGGGGATGCAGTGAGAGCTACTAAATAATCGGCAGTGAAAGTAGA
ATCATATTCGTCTACAGCTGCAAGCTCGCTTGGATATACATCATCCAGTACTACCCCAACGCCGGCTACAAAACAAATTAACAAGTGCATTATATATCAG
TGATTATGGCATCGCAACGCATTAACGTACGTACCAAGTATTGAACGCTTAAATTCGATACGCAGAAGGGCGAGCGACGAGCTACGAGGTACTGTTTGTC
CTTTACAAAGTGCATTAAAATCTTCATCTCGAAAAACTCGATCCGTTTCGTTATTCACATCGATGATCTCTGCGCGTCCTTCTGTAGTTTCCTGAGTTAA
TGATCTTGTTTCTTCTCTTTTTGCAGGTATATCAGCGGTGTCTTCTTGCCAGCGAAGGCGGCATCTACGATGAAAAGCTTGTTGGACCACTTCGTCTTGT
GACAAATATCTCAATCCAAGTCGTTGTGCGAGTATACGAGCTAATCGAGTTTTGCCACATCCAGGTGGCCCGACAACTGCAACTTTTAAGGCAGGAAAGT
CAATGAGCGTATCAATAACTGCATCTTCATAATTCCAGactgtttttttttcacGGTGAAGCTTTTGACTCCAAGCAGGAGTTGCTCCGATACCAATTTT
CCCCACAAGCTCCAGATGCACCTGCCGAGCAACCTCCATGTCATCAACATATTTATCAGCTCGGCTCGTTTGGATGAGTTCTGCTGTACTGGCAAATGTT
TCCTCTGTATCTATAGCAGCGTTCATGCCACCAAAAGCACGAGTGAGCGAGAATTTTCGCGGATTGTAACAAACTAGTAACTCTTTCAGCGACATTTCAC
GCTCATTTGGAGGTGGCAGACCCTCAATCTTCTGCATCGAATCATTCAGTAGTAGCGacttttttgaaaataaGTCGCTCGAAACTCTCAAGACTTGATT
GAATGGTCTCAACGTGAACCGATCAACAATCTTACTTGAGTTGTTCTCATCTTGCTCAGGTTTTAAGTCGAAAGTAGGCAAAATAGTTTCTGCGATGGAA
TGACGTAACTCTATAAGAAACATTGCAAATACACCGGCACTACTCTCAACAGGCAATATGATCTCAGCGATTTGCATAACGGCCTCACAGAATTGTTCGT
ATATCAAAACTCGATTGTCGACGCTTTGAGAGTTTTTATCAGATTCATAAACACCAGTTCCACCTTCCAAATCATATTCCCAGTCTCGTTGTGCTACAGC
AATGGCAAGTGCATCGGATTTTAGCGATAAAACGAGTGCTTTGGCAACTCTGGCGAAAAATTCAACGTACTGTTCGCGATTTAATGCAATACAAAAAATA
GGTTTGGCCACATCCCAGAGCTGCATCAATTCGCGTGTTACGGACGCATTTTCTTCACCTCCGTGAATCAAATTGTCACCATTTAACATGGCATTTCGTC
GATTGTGCCATAATTGAAGAAGATTTTCCTTGCCCTTGCCAACGCTACGTTCTGTTTCGTTTTCAGCACATAGAAAGTGTCGACGCATTGATGCTTTATG
CCTTCTgaatcaaaatattttggcGGACAAGTGTCTAGCGGCGCGGCGGTTAAAAGTCAATCCGTTGGTTTCAAGACTGTATTATTATTCAGCAGTGTTT
ATATCTGGTCGATTTTAAAAGTGATCTAAGCTAAATTTCGAGATCTAAGAGTGATACGggtcaagtcgagtgcgattTCAGCACTATTTGGGCGAGCAAG
AAGCGCTTTCTCAGCAAGATGCTGGTTTATCTTAATCAATGCTtcacttttcttcttcatcacgTGGCCAATCGACATTCGTCGAGGATGCTGCTTGGGT
GTTGCAGTCTCTTGCCTTACCCACGGATGTTGCAACGCAGCCGCTACTGAAATTCTCGTTCTCGAATTCACATCGAGAAGACCAACAAGTAGATCTATGC
AAGATGCTGGTATATTGGATAAGAGATCCGTTTCTTGAAGAGTGGTAGTAGTGCCATGTTCCACCATTTGGCAGAAAACTCTGTCACTTTCGAGCGACGC
GCGGTGTAACAAGGCTTGCTTCGTGCAAAGAGTCCAAAGAATGACACCAAGAGACCAGGCATCAGCGCAGCGCGCATCGTCGATCTCGTTGTGACTTAAC
AATTCGGGTGCAGCATAAGCTTCTTTTGCGACTTGGGAGATTCGCACGTTTGGTTTATCTGACCGAAATCGCAGGGCGTGACCCAAGTCTCCAACCTTGA
CTACGCCTGAATCTGTAACAAAGACATTTTCTAACGACAAATCCATGTGAGCAACTCCAGCAGAGTGCAGCGCGTTTACACCTTGTAGTAtggaaaaaaa
aataaagcgTCTTCCAGAATCAGTACTAGTTGTCACGAAAGAGGCTTGAGGGGTCACACCTGCCACTTGAAGACGAATTTCCTGTTGTATGATTTCAAGC
AAGTCACCACGATTACAGTATTCGTGATAAAGATGAAGTCGCTCTCCTTGCAGCAAGTGGAATTCCATCTTGACGACGTTATGAGCGTTGATGACCGAAA
AATGCAAGTCTAATTCATGCAACGCAGCAGCACATGCAATCCGACCTTCAGGAGTGCATGATGTCAAAAGAGTATTTTTGTCGATATATAAACGACCGGA
GGCCGCACACTCTACGAGATCGACACACTGAAGCCCATGTAGACTCGACTGTACGTGCGAAAGAAGCCTGAAGGGACCTTTCGTGTCGAGGGCCATTGAT
TTTTATGGCTACACGTAATTAACCACGTCCCGATGTTTTTGAACAATAAGCCCCAACGGCTGGTTCGATTTCCACCTATATTTACTTGCTGTACAGGTAG
ATCTTTGCCATTGTCGTAACGAACGACATCGCA