Description :
From Genome Similarity Track
Location :
Scaffold_370:10902- 13344
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_370-snap-gene-0.8P-type ATPase (P-ATPase) Superfamily

Sequence
2442 bases(100 bases per row)
ACTAGTTGATGTGATCTGGTACTGGAAAGGATACAATGGCAAGCTGAACAGAGGTGTGAGTCTCGGTACCGCTACGCTCATGCAGGGTTTCTTCTCGATC
TTACTGTCGATCCTCAACGTTGCGGGTCTGCTGTACGGCTGGAAGCTGCGGCGTATCGTGAAGGCCGTGCAAAACCAGCGCGAGTGCGACCGAGCAGCAC
TTGCGACCATGATGCCGCCGTCGCCTACGCGCGCGAACTCGATNNNNNNNNNNNNNNNNNNNNNNNGGGTCTCCGCCAAACGCTCAGCGTGAATCCTATT
GCAGACGTGCCAGAAGAGGAGCGCGCTGCGACGAGACGGACTATCATGGTTGGTCCTGGATCGCAGGGTGGTCGACGGAGAAGTTCTGTGGGGTCTTCAG
GCAAACCAGGGGAAAATGCGCCGGCCTTTTGCTCAAACAGCATCCGCACGAGCAAGTATACGTACTACAACTTCCCGTTCGTGTTCCTGAAGATGCAGTT
CAGCCGGCTAGCAAATTTCTATACGACGATCGTGGTGGCCCTCTGTTTCTTCAGCTTTTCGCCCGTGAGTCCAGTTGCCAGTTTGACGCCGTTGCTGATT
GTGTTTGCGACGTCCGCGTTGAAAGATGTATCAGAAGATTTGCGTCGACAGAAGGCGGATACACAAGTGAATACGAAGCCTTGCCACATTGTTCGGCGCG
ACAGCAGTGGCATGATCAAGCATACCGATGCGATGTGGCAGGACATCGAGATTGGAGATCTTCTGATTCTGAAAGATGGCGATGATGTCCCTGCCGACTG
TGTGCTGCTGGCGACAAATCGTCCTGACGGCCGTTGTTATATCGAGACTGCGAACCTGGACGGTGAAACGAATCTCAAGATCCGAACTGTTGCAAAGCCT
ACGAAACACTTTTTGACCCCTGACGCCATTTTGGAAAAGTATCAACTGCATGTCGAGTGCGATGCCCCAAACAAGGACTTGTTCTACTTTGATGGTGTCT
TGAAGCTAGCGAGCATTCAATCTGGGGAGGGTGATGCGAATGCGTCGAATACTGTTGAAGACACGAGTTTGACGATGGAAAACTTGATCTTGCGCGGGAG
TGAGAGTCGTAACGCCGAATGGACGATTGCGCTGGTGATCTACACGGGCAAGGAAACCAAGATTTCCATGAACTCGTCCGATGTTCCTCTGAAGAGAAGC
TTCGTGGAGAAGACGCTGGATACGATGTTTGTGCTTGTGCTCGTTCTGCTCTTTGGTATTTCCGTCGCGTGCACTCTTGGTAACAACAACTGGAACTGGG
ATTTGGACGACGACAAGTCCCCATGGTACATTGGCAAGAATGTGGAGAATGGATACATTTTCTTAAGTTATGTGATCCTGTTCAACAACCTGATCCCGCT
TTCGATGTACGTCACGATGGAAGGCGTGCGTTTCGTTCATGCTCGCTACATTGAGAACGATTTGGAGATGTACGACCCGCATACGGACACACCCGCGCAG
GTTCGAAACAGTAACATCAACGAAGACTTGGGACAGATCCAGTATATTTTTTCGGATAAAACCGGAACGTTGACGCGAAACGAGATGATTTTTGCCAAAT
GCACGATCGCTGGTCTCCGCTACAACGATATCGATATGGACTCTGTGAAACCTCCGCGACCTGGTACGCGCTTTAACGACTCGCGTTTGATTGGTCGTCT
GAATGCGAATCACTCGACGAAGAAGGAGATTCACGATTTCATGCTGCTGCTGACGATTTGCAACACTGTGATCCCGGAATACGACACTCCTGCTGCTGAG
GCGAGCGGACTTTCGAGTGTGACCGGCAAAGTCAAGTACAATGCTTCGTCTCCCGATGAACAGGCTTTGGTGTTAGCTGCGAACGATTTGGGGTACGTTT
TGACGGGGCGTGATGGCCCGATTTGCCACACGCTTATCCAAGGCGTGCCAATGTCGTTTGAGATCTTGAATGTTTTGGAGTTCAACAGTGATCGTAAGCG
AATGTCGATCATCTTCCGACACCCAGATGGAAGCATTATTTTGTACTGCAAGGGCGCAGATGATATCATTTTCGACTTGCTGTCTAAGTCTCAGCCGCAA
GGTGTCGCCCACGTGACGCGCGGCCATCTGCAAGAGTACGCATCAGAAGGGCTACGTACATTGACGACAGCAATGCGTCGTTTGACAAACGAGCAGTACG
AAGAGTGGCATCAACTGTATCGTCAGGCTGAGTTGTCTCTTGACAACCGTGCTGCCAAGATCGCGAAGGTTTCGGCTGTAATTGAAGTGGAATTGACGCT
TTTGGGAGCGACGGCTATTGAAGATCGGTTGCAAGATGGCGTAGAGGAATGCATCACATCGCTGCGAAAGGCTGGAATTAACTTCTGGGTTCTCACTGGT
GACAAAAAAGAAACGGCGCTCAGTATCGGCATGTCGTCACAC