Description :
From Genome Similarity Track
Location :
Scaffold_173:10902- 12184
Transcript NameFunction/comments
Physo_158894hypothetical protein
Physo_144216predicted protein

Sequence
1282 bases(100 bases per row)
ATGCAGATGATCGTGGAGTCGTCGTCGTCCTGTGCGTCGTCCTCGGGCGCCGCCTCCCACGTGTCCTGCTTGTGCTGCTCCTGCACGGCGGCAATGCGCT
GCGCGTCCGTCGTCTTCTTGCGCTGCATGAACTGTGGGGAGACAGAGGGGTCAGCGCCAAGGGCAGTAGGTAGTACAGACCAACAGCCAGAGGAGACAAC
GCACCTTCATGGCCAGCGTCTTCTGGGACAGCACGAACTTGGTCGGCTCCTTCTTCACGCCGCGCGGCGGCAGCCCGTCGCTCTTCATCGGCGCGGCATC
TTCCTTCTTATTCTTGCTGCTGCTGCTGCTGGGCTTGGCCTTGGGTTTCTTGTCCTGCGGTCGGTCGCTGCCGGGCTTCCACATCGGTGCGCTTGGTCTA
AATGGGATGGCTGCGGCGGCTTTCGAGAGTGCTCCATGGTAGTCAAAAAAATGAAATGAACTTGCAGTCATTAGGAAACCCTCTTAACATGATATGGATA
CATAAAATTCAGTGGACCACGCCACTGCCACTTGCACAAGTCTGCGCTATAGTTGGCGGGTAAAGTCGTCGCACCAGCGCTCAGACAGTTTCGTTGCCCG
ACGGATAAGCTTATCGCCGCTAGGTAACAGCGTAACTCGCGGCGAGTTCCTTGACAGAAGAGCTGTCATCGTGGTCAGGGATCCATGACTGCGGGGCCAG
TTTACGCCTCACCTCCTGCCATTGACGCTGGCTGCTCGTGGCGGCGACATCGAGAGCGGCACCTCGACGCATTCTGCGGCGATGTGATGGATGGCCCTAC
CGCCCGGCCCGCGACAACGCGGCAGCATGCCATCTTGCCGGCACTGCGCAAGCACCAAACAAATCGGGCGCGGCTGGGAAAAAGAACCAGTTGCGGGTCA
GGCTCATTTCGTCCTCGTCTCTTGTATCTTGCGCTCGGACGTCCCATTGGCCAAAACTCATTTACGGGCGCGGCTCCCTCGTGGACGCGGGCGTCGGACT
ATCAGACACGAAGAAGGCAGGAAGATCACAGCGGCCCCCCTTGCCTCCGCTCTACCCCGCCTACCACCTCGTTGCCGGCCCGCCCCCCTCTCGCGTAGAA
CCCCCCACCGTTGTCACCGCACTCGCCCGCGAGAGCCGCGCCTTATGACTGTGGAAGTGGAGGCCTCGGACGCCGCCATGGCGTCGCCCACCAGCTCGAG
CGGCACGGGCCCCGAGTCCCTGCGCCTGTCGGAGATCGAGAGCGCGCACCTGTGCCCCGCCGGGCGCATGAAGATGGAGGAG