Description :
From Genome Similarity Track
Location :
scaffold_6:109015- 110913
Sequence
1898 bases(100 bases per row)
cgcagaGCGGTCTACTGGTAAGAATTGAGTCTTGTTGAGCGTCAAAGAGGGAGAGGGCAACAGGGCACGACTCGACAGCTCAGGGCtcatgaacacggaa
cgtgtatgctagccgggcttgctggtcgtggaagcgaccgtgaagaacttcgagaagccatgtaagatccttatcgactccggagcgtcgggcaattatt
ctCGACGCTCCAGGATAGAAGGAAGTTAGCTGGATTCTGAGTCGCTGAAAgcacggttgagtgacaccgtcactgttcggtTAGCGACGAGAACTTGTGT
CACGGAGTCGAAAGTCCCTGTGAaactcggtgtcaagtttcttgactttgatagcatggAATGCTGTTTGGTCATATTATTGGTATCAAGGTATGAACTT
ATCCTTGAAACGGCATGGTTCGAAtaccataagccatggatcgattgaagtcgaagaccttgggcgctacgcctACGTCTCCCggtagagctttggtgag
tcatgacccAACcactgctaggaagcagaagcgctttggCGCGGatactggaccgggacggtcaatgtgcaagaagtcggagtatccgagatgTCAGCCA
CCAAAGATatagtcccgagcatggctcgtgggctgaatgtgaagtggcacgcaaCCCACTAAGCgcagctcaagtatcaaagccgtCGGTGCATGCCGTG
CGTGGTATGGTCAGCCAAGTGTCGatcatcgagggcaaggccctaatgatgtgcgtggagtggcacgtaatccacttagcactgttcacgtttcaaagca
gctgCTAGTGGAATGGTCGACCAAGgctcttctgatgcgcgtggagtaacacgttatccactggacgaagactgcggaggtagcagctcttcgtcgaatc
tGGTTAATAACGTCAAGACTCCGATGttgcagggagtggggatacttgacgacgctgagtgcttgttcccactggtctcgacgaGATGTTAAATCTCTAT
AGAGAGTAGACAGCGATGTCGTATGctttctgcaagacgccaggcATCGACCCTGAGCCAGGGTATGTCTCCCGTaaacgatggcgcacagctatTCGCC
TGTGTAACGGGAGCGGAAGACGGCGACCTcaacctcgaggctatttccgcggtggatgcaaTCCTTGGTGCTGAacaagatgtccttcaaagagttcgcg
gtgccttgaatgcAGGcgatcttgccgaggtgACCAtcatacgaccgaacgagaagATTAACTCgttatcgcttctggatgaagctttttTTGAGGACAC
CAAAAGAGTGCTGATCCCACGAAGCagattgtcgatcctgaagaatccctcagatccgtactattTTTTGgtgatttcaagacgtcgtctccaaagaccc
gctgtCGGTCCTGCCTtcagaccgaggtgtgcgtcatgagattgccCTGGTTTCAGGAATcagatactgcgtaacaagcCTATGGCCCCTGccaaaggag
cagtgtgacatcAAATATGCCTTCTTCCGTGTATGGCACggtgcaggaatggtgcatgagagcaagtctccccatccgACACCCatgctttgtgtttgga
agccaaacggcaagtggcgtaacgctcacgcttacaataagctcaacgctgtcaTTATTCCGACACAGGCTCATAGGAAGGATGctttccagaacaacat
ggttggatgtacaaagtacagctcactcgacttggtcgacgaGTATTCTCAATtgatcatgagagcgagagatattccgctgacagcggtgtgtACTTCG
AGCAGAATGCTCTGTGAGTGGccggtgatgccccaagggctgtcgaatacaccagcaacattaatcgtcttgtgatgctATTGTTTATGCCCACCGAG