Description :
From Genome Similarity Track
Location :
Scaffold_64:109007- 112287
Sequence
3280 bases(100 bases per row)
GAGACATTGAATGTCCTGGCTAATGACGGATCAAGCATAGGTAGTCTTACACACTTTATCTGATTGGGCCTCAGAAGTTAACGTTGGAGATCACTCAGTT
ACCCCCGCTGAATCAAAAAAGGTTCTTGCTTGATCTGTGTAGTGGCAAAGTCAAGCAGATCTGCTTACTCGTCGTGGAAGATGAGTACGTCAGTGATATC
CGATCGACAATGGTCTTTACCGAGGATGAAATAGTTCTTAGTAGCTCATCAATGAACGAGAGTGTCCTTGATGAGAAGACTCGGATTGAGTGATGTACAC
GCAATCGTGGTAATCGCTCAGAGCAATCCTCTCTACGATGAGTTCATAGAATTCAGGGATGTATTCCTAGAAGCAGTGCCGTGCGAGTTACCTAAGAACA
AAGGCAATCGTCACGAAATCGACCTGAAATTGAGTTCCAGGTACTGTAGTATGAAGAAATGTCCATTGCCTCGTGAACAAGCAATCGACAAATTCTTTGC
AGACCGCTTAGAAGCCAGCGATGTGAGAGGGTCGACCTCCCACATGGCTCTCCGATTTTCTGTGTGCAGAAATCCACAGGAGGGTGGTGGATAGTACATG
CCTACAAAAAGTTGACGCTGCAGCTGTACCGGCTCAAACACCAATACCAAGGAAAGATGTCATCATAGATGGTATGGCTAAGAGTACCATCTTTTCATTA
ATGGATCTGGTGGATGGATTCTATCATATCCTTACGCGCGAAAGGGACATTCCCTTTACTGCAGTGAGCACCCCCAGTGGTACGCTTTGTGAGTGGCTAG
TGATGTGACAAAGGCTAAGTATTGCCGTTGCCACATTCAACATTTGTGTGACAAATCTGCTCAGCTACTTTGACGATGTATTCGTCCATAGTAGGGCTAT
GGATGGACAGACGGATATGGAAGTACACCGACTCCACGTCCGGAAGGTTCTTACACTAATGCGCGAGCATAAGTTGTATGCCAACCTCAAGAAGTGTATA
TTTGCTGCTAGCGAAATACCACTTCTTGGTTGCATCGTGGGTAGCATGGCGTCCGGCCCGATCCGGAAAAGAGCAAGGCGATCACCGACTGGCCGGTTCC
TACAGAGGTCAAATAAATTCAAAATCTCCTTGGCCAAGCGGTGTATTTACGCAAATACTCGCACAATTACGCCGAGATGACTGTTCATTTCTCTCGTTTA
TTGAAAAAAACTCGAAGTGGGTATGGAGTGCCGATTGCTAGCGCTCCTTCGAAAGTATCAAGTAACGCTTGATACGATCGCCAGTTTTGGCAATTGCAGA
CCAAGACAGGCCATTCCATGTGGTCTGTGACGCCAGTGACTTCGCAATCGGCTGTGCATTAATGCAGTGCGATGTAGACGATGCGAAACGTGTCGTCTGT
TATCAGTCACGCCAGCTGCAACCAGCTGAACGCAACTACCCCGTCCATAATAAGGAACACCTTGCCATGAAGTACGCGCTGGCTAAATTTAAGGGTCTAT
CTGCCAGGATGTATACCCATTATCATCTATAAGGATCATGCGTCTTTATACACGGCCTTAAACAGTCCACACTTCTTGCAGCGAATGGCGAGGTGGCTTT
CATTCTTTGCGGAGTAAAACTTCTCCATTGAGTATAAGCTAGAACGACTTAATGTAGTCTCTGACGCGCTCTCGCACCGTCCCGATTTTGAACCAGCAGC
GCCACCCAACACTGGTTCTACCACTGTCGCGGTAACGACTTCGAGTGTCCCGTCGTCAACATTATTGGAAGCCATACGAAAGGAGTATGATCTGGGGATG
GTGCGATTCATGCATCATCTCTCGCACCTAGCGGGGAAGGGCCTCAAATAGTTGTCGCCAGTATATCGATCCTCTACGTATAGATATCCAGTTCGCAACG
GCTTATTCCAATATTCGGCTGATGCCGGGACACACCTCGTGTCGTCGTACCAGATCATGGTGACTGTAATTGCTTATCATGTATGAGTACCACGACGCGC
GTGTTGGTGGGCATCGACGTCGTGAGAAAATATATCTCACAGTGAGCTGCAACTTTTACTGTCCCCTCCAGTATCAGTTCGTGCGCAAGTACGTTCGGGC
CTGTAAGGTCTGTCAACGGATGAAGTCTATTCCTTCCCTTCAAACCCAGTTGCAGCCTCTGCCCGTCCTGACCAAGTGCTGGGAATTTGTCTCAATGGAC
TTTGTCTTCGGATTCCCCACAGACTCTCACAAGAATATTGGCATTCTCGTATTCGTTGACAGATTCAGCAAGATGGTACATCTGGTTGCTGTACCTGAAT
CAATCAACGCGTCGGCATGCGCCCGTGTCTTTATCGACAAGATCTTTCGCCTTCATGGTTTGCCTTGTGAACTTGTGTCTGATCGGGACCCTCGGTTCTC
AGCAGAATTGTGGTGCTGTGTGTTCAAAACACTTGGAACGCGCTTAAAAATGTCCACGTCTGACCATCCTGAAACAGATGGTCAGACCGAACGCGGGAAT
CGTCTTCTCGAAGAAATTTTTGAGGATACGTCCATTTTTACGAATTGGAGCTAATTCCTCCCGATGGTGGGGCTTGCCATAAACAATTTAGTCCATGCGT
CGACAACGCACACGCCGTTCTTCGTGAATTGCTTACACCATCCGCGTCTTTCTAAAATTTTAGAGTGTGACTCTAGTTAAGGGGGGAGGGGCTCATTCGA
GCGAACGCCAATTCGGTTCTCACTCGTCAAGTACTGACCACGCGGTAACCACTTTCGACGCCGATGTCGATGTCTATCACATCAAATTCGGTGAAGAAGA
GGAAAGAAAGAAAGAGGATGCTCTTAAGTCCCACGATACTGATCACATTAGCATCACGCCCTGTGCGTCCGATGACACACTCACAGAAGCGTCAAGTGAT
CTTGCTGCAATACACTCCACGAGTTGTGTGGCTAAAGACAGCGAGTCAGCAGATGGATTTATACTGGCTCGCGAAGCGGTTGTCCGTTTCGTTGAAGACT
CTATCGCAAAGGCGGTAGATCGACAAAAATGAAACGCTGACAAGAATGGAAAGGATAATGTTCTTTTTTTTAATAAAGGCGACTTAGTCCTACTATCTAC
GGTAAACCTACCTCGACACATAGTGACTAACGTGGGAAGTAACAAGTTACTACCCAAGTTCATCGGTACATTTCGTGTGCTGCGCCACCTAGGCAACGCA
AAAACGATTGAACTGCCACATAAGATGTGCACGCATCTTACGTTCTACGTCGGTCGCCCTTAGGCCGTACTATCAGTACG