Description :
From Genome Similarity Track
Location :
Scaffold_60:109003- 113521
Transcript NameFunction/comments
Phyin_T30-4PITG_17549Myosin-like protein
Phyin_T30-4PITG_17550Serine protease family S09A%2C putative

Sequence
4518 bases(100 bases per row)
GGACCGGACGCGTGCGGCACGTCGGACGGACTCAACGACCGGTTCTTGCCAGACGGAGACATCTTGGCTCCAGTATGCACCTGTTTCCTGTCCAGCTTCA
TCTGCAGCTGCGCCACCTTGGACCCGAGCTCCTTGTACGCCTTCTCCTTCTCCATCTTCCTTAGGAACACGAGACGCAGTAGAGAGAAGCGGAAGAATCC
TTGCAGGCGGCGAACAGCAGCCAGTTTCTTGAGATAACGCTGACGCTCCGTGTGCATGCGACAGTACGCCTGGAACCGCACGATGCAGTAGTCGAACTTG
AGCACGCGATACATCTTTCGCGCCGCCACGCCGCGGGCCTGCGCCTGCAGCACCACGACACCTCGACGCAGCGTCAAGTAGCGTTTGTGGACCACGTAGC
GCCGCCAGTACTTCTGGATGACCACGATCTGCTGCTTCTGGCGCAGGAAGCGACGACGCATGAGCCAGCACAGCACGTTCTTCTGCAGCACGATCGCATA
CTTGCGTAGCGCCCAGCCGCGCTTGGTCTCGAGCTCTTCCAGCACTCCCTCGCGGAAATACACACGCGTGAGGCCCACCTGGTAGTCCTGGATGTTGCGT
CCCGGCAGCAGCTTGTCCATCAGCTCTTCGCACTGATCCTTAATGTGTTCCGTGTCCGAGTCGCTGATAAACTTGCTCTGCGTCGGAACGGCGCCGGTTT
GCAGCACGCGGAACTTCTTGAAGCACTCGAGATGAGGCATACGACTCGGATACGCACTGCGAGACACGCGGATGGCCTCAATGACACCGGCGCAGCGCAG
TTGACTCACAATGTCGCCGTGCGAGAAGCAGTGGGCACTTTTCAGCGGGTTCGGCTTCAGACAGCGCACGTAGTGGACCTCGGTGAGCCCGATCTTCTCC
ATGAGCTGCGACAGACTCTCCTTGAACTGGGTGCCGACGGTCGTGCGACGCGTCTGCGCGTGTCCGCCCTTCTTCGCACTAGTGCTGCGTGTTCTCCCGC
GAGCCGAGGACGCCGTGGAGCTGGCGCTGCTGGCGTTCACGTCGTCTGTGAACATCTTGGACAAGATCTTGAGCGTCGACTTGCTCATGCACTGCTTGAT
ATCCGGCAAGATGGCGTCGCGGTGCTTGTCCAGGAAGCCTGACGCGTCGTACGTCACCTTACCCGCGTAGTGGTAGATGGAGAAGGCGCATTTGTTCAGT
CTCGGGGTCTCCAGCAGCGGGTTGTTCTCCATCACAGCGCCCAGTTTGCTCGCGAACGACGCGTCTGTGCCCGTCGCAAGCAGCGATTCCTCGTTCAAGA
AGCTGATGACGCCCAGACGACCTTCGATGAGGTTCAGCACGTCCTGGTTGTCTGCGAACGTGATGTGCGACCACGAAATGTTCTCCTCCTCGTACTCGAT
CTGCACCGTCTTGAGCACGTCCTGCACGAACTTCTGCTGCAGCTTCTCGTTCGCGTAATTGATGCAGAACTGCTCGAACGAGTTCGTCTCAAAGTGCTCG
AAGCCAAAGATGTCGAGAATGCCGATGAACGAGCCTGCTCCCGCAGTTTTCACCCCGATCGTCTGGTTGATCTGCTCCACCAGCCACAGGAAAAGCTTCG
AGTACAGGCTCTTGGCCAGCGCATCGCGACAGTCCGCCGCCTGGTCGCGTGTCATGGGCTTCAGAATCACTTCCCGACCCACAAACACGTTGCGGTTGCA
CACCGCGCGCTCCAGAGCGTCCACCTCGACGCCCAGAAGGCGACAGGCCACTGCGAAGTGCTTTAGATCCGCCAGTTGGGACGCGTCGACGTCTCCGTTG
CGCGTAGTGAACTCCGACTCGCCCAGATGCAGCACCGCGCCCAGAATCTGGATAATCTCCAGCTGCAACGGCTGCTCGATGCCCACAAGCTCCAGAGCTT
CACGCGTGCGACTGAGGTCTCCTTCTTCGTCGCCTCCGGGGGCTTCCGCGCGCTCGGAAACGTACTTGAACGAGTTGACCATGTCGAGCTCCAGATCGGG
AAATTGCTTGCGCTGCGCCAGTAATTGGTAGAAAATGTGGAAGTTGCGCTCGCCATCCGCCTGCGTCGTGACTCGACTCTTTTCCAGCAGATACGTGCGA
GATCTGGCGCCGATCAACTGGCCTTCCATCGTGAACTGCAGCTCCGTGAACTTGCCGAACCGACTGGAATTGTCGTTGCGCACGGTCTTGGCGTTTCCGA
ACGACTCGAGCAGCGGATTCGCTTTGATAATCTGCTGGATGACTTTCGAGTTCGAGTTGGTGGCAAGAGCTGCCAAGTGGCTCATGACGATCTTGGTCGT
CTCGGTTTTGCCAGCTCCGGACTCTCCTGAGACGAGGATGCTCTGGTTCTCCTGCTTTTGCCGCATGTTGAAAAACGCCTCCATGGACACGGCGTAGACG
TGGGGCGGCTTGTGTTCCCGCTTCCCGTCGCTGAACTTCTCCATTGTCTGCTTGGAGTACAGATCCAGCCACTGATAAGGGTTCACGGCGATACAGATGC
GTCCTGTGTATGTGTCTGCAAATTGTTGCCATTCGGCAAAAAAAAGTGTCAGTGGCGTATCCAACCAGAGGCAATTAAAACGAAAAAGGCAACTGCAAGA
AGTTGCCAAACGTACATGGCAATCGACGGAAAAATCGTCTTCGCAGGTTGTACAGGATGGACGCCTCGTGCAAATGATCAATGAGAATCATGTCCTCGAA
GCCATTGGCGCTCTCACTCGTATTTTGCAGAGGAAGCGACGGTTTGTTGTCTGCGGACTCGACTGATGTGTTCTTGGCGTTGAGCGCCTCCAATACCGAC
GCGTCTGTGAGGTCCACGGCACGTTGCGACCCAGCGAACGCACTGAGTTCGCGCTCGGACGGGATGTGCTCCAAGGCAGACGCATCTTTGGGTCCCACGA
CCTCATCTAGTCGCACCGTGAGCTTCTTGCCATCTCCGCTAGCTCCACATATCACGCCGGGAAGCCACACGTGCTCTGTGTCGGGGGTAAATACCTGCAT
GATGTGGAAAAGGATGGAACATTTGCCATTAGCCTAAAGCGACAGGGGGGCGTACAAGTTTGTTGCCAAAGCCAAAGACGGGGGAGGTGCACCTTAATTC
CCTCCATTGTTTTCCGCCTCTTCGACGCCGCTTTTGGTCCTGCGTTGTTGGCGTAGTGAGGCTCGTGCTGTCGTATGCGCTTTTCTCCTTGCCCCCCTAC
GGATAGGGCAAAAAGTGTACTGTCCAATCAGACCGCGCTAAATTGGCAAGAAGTGGCTTCATTCGTGTGGCGAACACATTTTGTGCTTGAATTTCCAGTG
TTTATGGTTACTACTAGTACCAATAAACATATACTAGTAACTTACTAGTATCGGTGTGTGAAGAATTAACTCGTACCATATCCATGGATACAGCTGTGGC
TGCATGGCGAGACAAGTGGTGAGCCCAAGTCAGCTGGCGATGGCTAGTCGCAAGGTGGTGAAAACAAATCAGATGGGCGCAAATTGGACCAAAAAATTCG
AATTGAGCGACGTATTTCTGACGGCCACAATCCAGCAGAACCATGCTACGCACGCGTCTTGGTGCGAGGCTTTTGGGCGCCAGCGCGCGGCGATCTGCGC
TGTCTCGAGAAGCTACACAGTACATCCATGCTTCAGCACTGATCAAGCAGCAGCTAGGATGCTTCGCAGCTAGGGACGCGTCCTGGGAGTGGCTCAAAGA
TCCCGAGAACCCTCGCTTGCAACGCTTCCTCAAGGTACCGACGCTTTTGCCCGTTTGTCACTTTGGAGTATCTCTAAACCTCTGCTGCAAAAATGTCTAC
CAACGTTTTTTCCCCAGCTGGAGCGAAATTATCTGGTGAACCAGCTCTCCAAGCCGAAGTTCCGGAAAGTGGAGCGCGCATTCAACGTAGAGCTACGTAA
TCGTCTCTTGCGCGAAGACTTTAGCATCCCCGAGTGCATCGGCAAATACGAATACTTCATGCGGCAAGCACCAGGTGAAAATTTTCCCGTTTACTACCGT
CGACGTCGAGTTGCCGAGTCGGATGCAACGGCAACTTCAACGAACGAGGAAATTGTGCTAAACCAGAATGTGGAGCCTTCACTTAAGCACGGCTTTCAGT
TTGTATCCGGTATGAAAATCTCCCCCGATGCAACGCAACTGCTACTCGTCATGGAGAACGACAACGAACAGTGTCGCGCGGTACTGAGAGATTTAAAGTC
GGGGAAGTTGCAGCCTCTGACAGACGTCACGGACATCAAAAACGTCGAGTGGAGCTCAGCGCCTCCGCCGAAACGCGTTTTCTATTATACCAAAGTGGAC
GCGCACGGACGGCCGTTTGCAGTGTACAGATACAACTTGGCAACTCATGCGCAAGAACTGGTACGTGACGTGATCATTTCTCTTTCGAGTTGAAGTGGCA
ACTGACAAGAAGGGGGATGGGTCTGCAACATTGCAAAAATAATGCTGAATGTACATATAGATCTACGAAGAGCAGGACGAGGCTTTTTTCGTGGATGTAT
CGCAGACGAAGGACGCGC