Description :
From Genome Similarity Track
Location :
Scaffold_615:10900- 13581
Sequence
2681 bases(100 bases per row)
TGCTTGTTCCGCGTCAGAGAGATTTCCTCGGAGCTTTTGTTTCGAGCGTTGAATCATGTTATGTACGTCCCTGAGGGTGGTATGTTTCCCTGCAGTGGTT
TCAAACAAAACATACCTTAGTACACCGAATGCTTACCAAATTAATACCAAACGCGCACAATAATTCAACAAAACAATACCGCATTGCCATGCGAAACTTA
CCGGTTCGATCTCGTAAGTGCTGAAGAATTTCTTTTGCGTGTGCACCAGCTTTATGCATCTTATGGACTTCTTTCTCCAAGTGAGCATTCTTAATGGTCC
GATTCTCTGCATAGTCGAACCACTGATGGGCGGTTGTTGCGTGGTTATGGTAGCCACTTTCTTTCAACGCAATGTGGCAGCCAGACCCTCGACAAGATGT
TACTCGAGCGTTAATTTTTGCTGTGCACTTTGTATCGCGGACAACAAGGTGATTTCGCTTTCCTTTCCCTCGCTTTTTGTGCGTCTGACCGTGCGTACAC
TTGAGCGTCTTGCAATAAGTTCCAAACGAGTCTGGTATCAATTTGTACGCGACTTCACCACACTCTTCTTCCACTGTAGACACCACGCTCCCGTCAGCCC
CACCATCAGCACCGGAACCGAACACTTCCTTCTTCTTGGCAACTATTTTCTTCTCGGCAGCTTTTTTAATCTGCTCGTTACGACTCGACACAGACGTGCT
CGTACGAGATGAAAACTGCTGAAACGTTTTGGCTTGAAATACGGCAAAGGCTTCATCGAAAGTCTCCCATGATGACCAGCGACGGCTCATACCTTCGAGA
ATACATCTCCAGCAAAGTCCGAACTCGGGATTTTAAGGTCACCGGAAAGAATCCGGTCACTCGTGTGGTGTTCATCCGGTTCAACACCGGAAATGGGACC
TTCACTGCTGGTTGCCTCTATTATCTCGTCTTCATCGAAAGACTCGTGAGCACGGCGACACGCAACACTAGACTCGGTTCCAGCAATTGCAGGTATCTCC
ATTGCACGATCGCCCACGTAGTCCGAGTCGTTGCTATCCGAAGGAGGACTTTGAGCATCTTCTTCATCGAGCTGAGTGAGGACTTCACCAAGCGCACAGG
ACACCATACCAGCGTTATCTTCTTGCGAGCTGGACTCTGCAGGTGCTTGACGCGAGCCAGTCTTCCTTCTCTTGCCTTGTCCTTTTAATTGTGGAGCAGC
GTCTTGACGACGTTTCGCTGCTACACGCTGGGCCTTTTCCAAAACACTTCTGTCGAAAACTGTGTTTTCTGGTAAGTTTAGAAGAGCGTTGAGTTTGGCT
ACCTTCGTCGTTCGAAGCTCAAGCATTTTTCGTCTTTGCGGCGCTTGCTCTTCCCGCTCCGCGATCAGCTGAGCGGCCTTTGGTAAGGTTGGTGGATCGC
GCGCACTATCACTCAGCAGATTCATTCGGCTTCCAGGGTACGCTGGGATGTCAGAAGCCTACCAAAACCAGATTAAGTGTCAATAAAGCTCAGGTAACAC
GCACAAGGTATATAATGTACAGGTTGGAAGCCTAAATCGCTTTGAAATATGCACGTACCATGGGTGAAGCTGTTCTCAAGCTGCACAGGGTGGGCCGCAA
GCAGGGAGGAAGAGGGAGGTTTCTGTGGTTTGCCGTCTAAAGGGGGAGCGACGAATGCCACTCAAATTGCACTTGCCCTGCATTCCAAATACCGGTATTA
AGAAATCAAGATGACCTGAGCCTGTGAATCCCCCTTTCCCTTCTGTAGAAGCGGCTGTTAACCCGACTCTAAATGCAATCGGATTCGGACATGATTTACA
CATTAAAAACATAAAATATTGTTGAATTTCCGGTAGCAGCAGCGTGTTCCAACAAATTGCACGAACACAGAAAGAACATGCGGATGCCACGAACCAAAGG
CCCATCGCTTCCGGCGTTCATCCAGCTGGTTCGCAGTCAAACGTCTGCTGATTACCGTCTCAGCAACCGGATACCCGAAGCTCGTGCGTCTCCAGAAAAT
TGCTGCAGAAGGCGTGCGCGTCCATATCCGCGGCTCAACCGCACAGCAATCGTCCCGCGCTGCAAATCATGGTTCAGATCACTAACGTCTGAATGTGCTT
TGGAAGTATATACGAACGGAAAAAGGACTCGTGGCGCTGCCTGGTTCTAGACATGAATATACTACACCATTTCCCGGCCAAGTTACCAGTTTTACCAACC
ATCGTGCAAATGGCCCGTTCTTGTGAGATCTAATTTAAGGCTGTGTGGAGACACACCATTTTTAATTTTAGGCTACGGCATTTGGCGATTTGCAAGAAAA
AGCCACTTTTCCCACGACTTGCATTTCTGCCCATCACGCTTTTCAAGCAGGTTGCAAACCTGGTCAAATACATAGAGCGCTACGTTACCGCATGCTCTGA
CGCTTCAAGGGTACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN