Description :
From Genome Similarity Track
Location :
Scaffold_458:1090- 3997
Sequence
2907 bases(100 bases per row)
GTTCAATCAGAAGCTAGTGGCTCTTGGCTGGGTGTACGAAAACAGAGCGAGTCGCTGGTGCTGTCCCGCGTTACTTGTGAGAAAACCTGGCACAGATGAA
TTCAGACAGACCAATGACTACCGACCTCTGAATGCTGTGACGGAACCAATCGCAGGAGTAATGCCAAGTTTGGAGGTTGCATTAGAGCACTGCAAGGGCA
AGATGTTCTACGCCGTGTTTGGCTTCCTCAAAGGCTTTTGGCAGCTTCCGCTCGATGATAGCTGTCAAGAGTTCCTGTCTTACATGACCGACAAGATCTT
TTTTACTCCGACACGTGTGCCGCAAGGGAGCACAGACACAGCGCTGCATTTTCAGTCAACGATTGAGATGGTGTTGGGCGATTTGGTGGGCACGTCTGTC
ATAGTCTGGATTGACGACCTGCTCGTTTTTGCGGACACGGCGGAAGAGCTGCTGGAAGCAATTGAGGCAACATTGACACGCCTGGATGAATACGGGTTGA
TCCTCAATCCTAAGAAGAGCGCCTTATTCCTGACTGAAGTGCGATGGTGTGGAAGGATCATTATCAAGGCTGGCATCGGTCATGGCCCCAAACGCATCCA
AGCGTTACCAGTGCCGACAACTGCCGCTGAGTTGCAGCAGTTTTTGTGTGCAAGCAATTGGATGAGATCAACTCTGGTAGTCTACTCGAGAGTGGTCAGA
CCTCTGCAGGAGTGCCTAGATCGCGCTCTGAGCCGCACGAAAAAGACAAAGATGGCCGCGGCGGGGATAAGACTGGAGCTCACTGATGACGAACTGAGAG
CATATTCCGAAGTGAAGAATTTGCTTGGTAATTCAGCGATGCTGGCTTTTCCTGACCCTGCAAAGCAGCTATGTGTGCTGTCAGACGCGTCAGATTCTGG
TTGGGGACTGGTAGTCACGCAAGTGAGTCAGTGGCAACCGGACGTACCAATTCACGAGCAAATGCATGAACTCCTGATCTGCATGGGAGGAAGCTTTACT
GGGTCGGCGCTCAATTGGAGCGTGATCGAAAAAGAATCGTTCCCGATTGTGCAGGCATGTGTGAAGTTGGAGTACCTGCTTTTACGACCGCAGGGCTTTC
GACTATACTATGACTACCGGAACATCATTTACCTGTTCTGCCCTGGGAAAAGGCTCAAAAAGCACGTGAGGGGAAAATTACTGCGCTGGTCGACGAAGCT
CTTGGCGTACCGCTATACCATTGAGCATATTGAAGGGGTCCACAACGTGGGCGGATCTGATATCGAGGTGAGGTGGCCGAGCACTGCCGGCAGCACGTTT
CAACGCGGTGAAGCGTTTCACACGATCAAAGAGGGCACCTGCAGCGGCCAGTGGCGATAAAGAAGACAGTACTATGACTCCGCTGCGTCCTCTAGACGCA
GACAATTTCGTGTGGCCCACCATTGAGGAGATTGGTTGCGAGCAAGCCCGACACATGGCTCCGTCGAGGGCAACCCTCGATGATGATGATTTGTGGCGTA
TTAGTGGAGTGATTTGGATACCGAGTGGGGCTACAGACCTGACTCGCAGACTGCTTATTATTGCACATTGCGGTCGCAACGGGCACCGCGGTATGCATGT
GATGCAGAATCACATTCGCCGGTTGTTCTACATTACTGGTCTCAACGGGATTGTGCGCGATTTCTGCTCGAAGTGCTTGCTTTGCTTGCATGTGAAGGGT
GGGGTTATTATTCCTCGGTCATTCAGCGAGACCCATCACACGTTTGAACGTAATGAGACTCTGCACTGGGACGTTTTGACACTCGGTGAATCTTTTGGTA
CATCTCGCTACGCTCTAGTTCTTAAGGACGAGGCAACGCATTTCGTCGAGCTAGTGGCTTGTGATAGCCCGACTTAGGAGGTGGCTGTGAGTGCGATCCT
GGATTGGTACAGTCGCTTCGGAGTGGCTACTGTATGGGTGAGCGACGGCTGCGAGTGCGATCCTGGATTGGTACAGTGGCTACTGTATGGGTGAGCGACG
GCTGCGAGTGCGATCCTGGATTGGTACAGTGGCTACTGTATGGGTGAGCGGGATCACCGTTTAAAAGCAAGGTGGTTGCTGAGCTCAGTCGGAGACTCAA
GGGTCGTCAAGAATTTATCCTCGCATACTCGCCTTGGAAGAATGGCTCTGTGGAGTGAATGAACCGAGATATTTTGCAAGTGCTGGAAGCTTTGGCACTG
GAGTTCAAAGTAAGCATCCACGGCTGGCCCTACCTGCTACCACTAGTGCAGTCGAGCATTAACCACTCGCCAGTACCGTCTCTCTCCAACCGTGCCCCAA
TCGAGCTGTTCACTGGATGGCCATGCCCGAGCATATTGGACACAGTTTTCTTTCCGGGGGAGAAGGGGCGTCGCCGAGTGGCTACATTGGACCAGCTCCG
CCCTAGCACGGAGCAGCAGCTCACGAAGCTGCGAGAAGACATCCGGGACATGCACAAAGCTGTGAAAGCTGAGCGAGAGCGCCAAGCCCGGAGGTACCGA
GGGCGACCACACTACGAGCAAGCAGTGAACTTTTCGGTCGGCGACTACGTGTTGAGGTCACGTGTCGACGAAAAGTTGCATGCAAACTAGCTGCGTGTGA
TGTGGGTCGGCCCGTACCGTGTGGTTGGCAGCGCTGACTACTACTTCACGGTGGAGCATCTGATCAACGGTAGCACGTTGGACGTGCACCCATCTCGGCT
AAAGATGTACGCTGATCACTCGCTCAATATCACTGAGGAGCTCATCGACCACATCGCTTCACAAGGAACGGTGCTCGCTGTGGAAGCGATTGTGGAGCAC
AGGATGAACACAGACATGAACGCATACGAGGTGAAGGTGAAGTGGCTGGGTCTCGAGACAATCGAGGACTACTGGGAACCGCTGAAGACGATGAGTGAGG
ATGTCCC