Description :
From Genome Similarity Track
Location :
scaffold_728:1090- 2555
Sequence
1465 bases(100 bases per row)
CCTCGATAAACCCATGCCTTCCACGCTGCCAGATACTTATCCTTTTGCTGTGTGAGCCAGAGCATTGCCTGCTTCATCTTCTGCGTCTTGCACGCCACCA
GTATTGATGCCAATCCTACACCCCCTGCTTGCTTCGGCGTGTATAGCAGTCCTGGATTCACCTTGTGTCTCGCTCCCTGTGATGATGTCGAGTGCTGCCA
TAGAAAGTTTTTCTGAATATTGCGTAATTGTTTTTCCGCCCAGTCGGGCATGTCAAACACCGCCGCTGTGAACAATGCCGATGGCAACATGATCACGTTG
AGAATTGTCACGCGATTTTCAACACTGGTTCCCAACTGCGTAGCCGTTGCTAGTCGTCTCTGCACCTTTCTGATGCGCCCTGCCCAATTCTCTGTTGTCA
CATCCCCTGTTCCAACTGCGTATCCGAGATATCTCTCTGATTCACCGTTCGCCAGCACCGGTATGCCCTCGTACGTTTCTCGTTCGACTGCCGTGTTGAG
AAAAATGATCTTGCTTTTCGTCGGCTGAACTTAGTCCTGAAATCCGTCCAAACCTGTTGACTATATCCATAACCCTCGGAATTTGTTTCGCTTCCTGTAG
GAAAACTGTGGAATCATCTACAAAGGCCGAGAATTTATGCTGCTTCCCTTGTTCATTTGGAATCTGTAGTCCGCTCACTCCAGGATCCTCATTTATTGCT
ATCGCTAATACCTCCGCTGCCAAAATGAAAAGTAACGGCGCTAAAGGACATCCTTGTCTGATCCCCGTTTCCACCGATAGAGGTTCCGACAATTCTTGAT
TCACCAAAAACTGCGCCGTCGTGCCGTGATGCAAATTTCTGATCATTTCAACAAATACCTTGGAGAATCCAAATTTCTGTAGAGTCATGAACAGAAAATC
CCTCGCCACTGTATCGTACGCCTTGCGAAAATCTAATAGTAAAATCGCCCGGCTGCTGTCCGCTCCCAACTCCGGTTCCTCCGTAGCTGTCCCCAACATC
GCCATCATCATCATCACTGTTTTCATCATTTGACGTCCGTGTACAAAACCTTGTTGCGAGTCCCCAATTGTAACTCCCAGAACTTGCTGCACCCGGGTCG
CCAGTATCTTAGCAAAGACTTTGTACCCTGTTTGAAGTAATGCTATTGGCCTGTAATCCATGGCGTCATCCGAATCTCCCTTCTTCCGCAATGGGGTTAT
CACTCCCTGTAAAAAGATTTAGGCGGGTTCCCACCTTTGAGGAGCTCGTTCGATATTGTCACCATCGGGTGTACTAAGAGTGACTGGGTGTCTTTGAAAA
AATCGTTGTTCAATCCATCCGGTCCCGCTGCTTTATGCCTATTTAGTGCTTCGAAAGCTTGAACTACTTCATCTAGCGATATCTCCTTCACGAGTAAGTT
ATTGTCCATGTCAGTCAACCTTCGCGCTTCCGGAACTTGAACGAAAGTATCAAATTCCCTCTCCA