Description :
From Genome Similarity Track
Location :
Scaffold_146:109- 4909
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_146-snap-gene-0.19Transmembrane anterior posterior transformation protein 1 homolog
Pytap_DAOMBR444snap-pag1_scaffold_146-abinit-gene-0.93Pumilio domain-containing protein

Sequence
4800 bases(100 bases per row)
ACGGCCATgtCGCcGTTggccatGCAgcggatgcagcggctccacAACCTTCAtATTCAAAcGGACTTTGCAgTGgCATCGTCGACTCGTGCATCtCCTT
CGTCTCCATCTGGCGCGCGcGCCACACCGCCGAGCTCCCCTCTATCGATCGAAAAGCGTCTCGCACGGGCTCCATCCGCCGCTGCCGTTGCGGCATCGTC
ACACGCACACGCGTTTCGCCTGtcGGACTTTCTGTATAAGGAAGTCTTTGGCGTCCACGACATCAAGCCCAGTGATGGCATGCACCAGCAACGTGTACAC
AACTTCCTTGTCGTGCCGTTCAACATCGAACGGCTGTTCGCGTTCGGGGTCTTCCTGGCGCTCGACAGCTTCCTCTACGTGTTCACCTACCTGCCGCTGC
GTATCCTGTtcGCCTGTGGCTGTGCCGTGACTTCGGTGTCTTTCCACACGCGCGTCTTCCGACGGACTCACTTCTACGATCTTATGGTAGCGGTGATCAT
CGCAGCCGGGACCTACGTCCTGTGGCAAGTcGACATGTCCCGCATGTACCACGTGATCCGCGGGCAAGCCATGATCAAACTCTACGTGCTCTTCACTATG
ATTGAGATCTTCGACCGTCTCTTCTCATCCCTTGGCCAGGACGTACTCGACTCGCTCTACTACACAGCACGGTTCCAGCCTCGCCGCGTCGGGCGCATGG
CCATGGAGTTCGCCGTCGCCATCGTCTATGTCGATATCCTCTTTTTACGCAACGTGATGATGGTGGAACCGCTGAGTTGCTGTCTTGGAGATTCCTTAAC
CACGGTGCACTGCTCCATGCCTTGTTGCTGTTTGCTCAGGTCGTCACCATTAACGTCGCAATCAACTCATCCAATACGTCGCTGCTCACGCTTCTGATCT
CCAACAACTTtGCTGAGCTCAAGGTATGAACCGCCCTCGGTGCTGTCGCGATCGTGTTaCcTGTGCCTCACAAAGTGCTTTTGCATTCCATCCTACAGAG
CTGTGTTTTAAGAAGTTCGAGGAGCAAAACCTGTTTCAGATCAGCTGTAGTGACGTCGTTGAGCGTTTTAAGCTTCTGCTGATCATCGGCCTCATTCTCC
TCCAGTCGAACGCTCGTGACGTGGCGTATGGCACCGTGCGTGGTGCTTCGCTCTGGTGTCAATtGCTCTTTTCTCTAACACtGagTCTTAaCCCCTCCTG
TAGACTATGGTCATGCTCGCAGAGATGCTGATCGACTGGCTCAAGCACGCGTTCATCACCAAGTTCAACCACATTTCTCCCACCGTCTACTCCAAGTTCA
CCACGATTCTCTGTCGCGACCTCACGGGCTGGAACAACCAGGACACGATCCTAGATCACACGCACCACGTGTCACGCCGCCTTGGACTTGTGTCGCTCCC
TCTGGCATGTGTTGTCTTGCGTATGGTGAGCAAAGCGCTGTACGACGATGCACCCATCCGACTCGCGTCGTTCAGCGGCGTACTCGTGACTCTCGCCTTC
TTCCTTTGTCTCGCTGCCTTCAAGGCTTTACTCAGCCTCGTCCTCATGATCTACGCGTGTCGTTCTGGGCGTCTCGACGACACACGCCCCAAGAGCCCAC
GCGCCGTGCGCCAGCTCGAGTCTATCCAGAAATACAAGTTTTAGAGTCTCAAAGGCGCATTTTTCCAGTACTGTATCGTCTTCTTCGTGTTGCTTTTCCT
ACTTTTCTCATGGTCTTGGTGCTGTTTTTCTAATCTTCCTATCTGGTCGCTCGCGTGCTTCCGAATgTGGAGACACATCGCGCGCTTGCTTTCTTCATCG
TCACGTCCTTCACAAaCAAAAAATCGGCTTCTTGTGCACAAACAGCGCCATCTTCGGTTCACTTGGTCTGTCGTTCACTCatGCCTACACGAGTTCGCGT
CTGCGGTCGTCTGCtcGCTCGTACTCCTTCTCGCCTCGGACATACTGATACAGTTTACTTGTACATCGCTCGCTTTCATCCTTCTTCTACATGTGGCCgC
CGACACCGCCGCCACTGTGCATCATCGAAGCTTCGTGGAGACGCATACCCAGCGCCGCAGCACTCGACTGCGATGCAAACGGACCCATCATCGACGCCTC
AGCCCcATTAGGgCCCATgCcACGATCACGCACATGTGAGCCCATCATGCCATACGGCGACCCATAGTGgTGCTGCTGGTGATGTGACACATACTGCTGC
TGGTGCAGTGGCATGgCTCCTCCAACGCCACCCATGCCATAaCCAGGGACGCCAGGTACAGCGGGCTCAAAGCCGAGGTCCAAGGTCAGGTCCATGTGGG
GAAATCGCTTCAGAATGCGCGCAGTGATACGaCGGCCGCCCGAAGTGTTCTTCATTGCAGGCAGGTGCGGGCGGATAGCCTTGACAAGAGCCATACACTG
GTCCTCCGTCGCCACGCACAGCGCACGCTGCACAACGTAGTTCGCGAACTGGTCCTGCAGCATCTTCTGCATCTTCGGGCAGTTCGTgaTCTCTTCCACA
TACTCCTTCAGCACTGCAGGAGGTGCCTTCTCCAAGCACTTCTCGATCACGTTCGAACTAAATTTCTGGACAGACAACTCAAATACATTGCCAAGAGGCT
TGACAATCACACCATACGCTTCGTCCGCCGTGCATGAGTCTAGCACATACTGgACGACGTAGTTACCGTACGGATCTTGCATCAACTTCATCGCCTGcTt
CTCCACTTGTGTGATTACTTCACGCTTTTGCTGATtGTTGGCAGCATCGAGACACCGCTGAAGAACACAGCAACCATGACGgTGGGTCCCAACGGTGGTG
CACTCCTTGCAcACCGCGTCGAAGACAAATTGGTTGTATTCTGGCTTCATGAACTGCAGCGCGCGTTGAATGACGTGGTTGCCATTTGAGTCAATACACA
AACGCACGGCGTCATCCTTCAGGGCTTCCACAATCAGATCAGGTAGGTTCACGCGACGCAGTTCGTTGCCATCGCTGTCGAGTTCCACCACCTGAGCCGA
TGTGGCGCACACTTCAACAACCTTCTGCACCGATCGAGTCCCGTGCAGGTTCAGTGCTGCCGCAACGAGATGACCACTCACACGACGCACGATCTCCAAT
CGCTGCAGTGGCTTTGCTCGTTCCAGCAGCTTCTGAAaCAAGTAGTTCCCGAACGGATCCACCATCATCTCCGCCAGGTGGTCCATCGCCTCGCTATAGA
TGACATCGCACAAAGACTTTCGCTCATCATAGTACTCCAGCTGCTCCTGGAGCAGGCGACAGCCATTTTGGTCCTTCGACATGGCGAACACACGGCCTTG
GACGTCTTCCACCTTAAGCAACGTGTCGGCTGGAGCGACCTGAGCCGCAGGCGCCATTCCTAAACCACCACCAAGGGTGTGGTGGTGGGATGCGTGAGTC
GACAAGCCCAGGGTGGCTGAGCTTGGTGCATGCAGATCACCAGTGTTCATTCGGTAGGAAGTGCGATTCGATCCGGCTCGAGGCATGTATCCAGAGGACG
CCGACGAAGCAGCCATGACATCGTACTCGTGTCCTCCGTGCATTGCGTTGAGTCCCGAGTGGTGCATCGAGTGCTGCTGCTGCTGGTgAAGAGGCGACGA
CGCTGGCGTCAAATGAAATGACTGGGAAGAATGGAGCTGCGGCTGTTGCTGGTGGTGATGCTGGTGGTATGGAGACGCCGACACATGCGAAGACGGCGCG
TGGTGCGCGAACTTGCACTTACTACCCATACGGCAGTGACCCTGCAGGAAAAaCTTGCACTGCTTGACACCATACATGCCCGAGGACCCAGGAACAGTGT
GTGGGGATGGCGGCGGGGACGACTCCATCATCATCATGCGTCCACTCGTCGTCGACGCGTACATCGATTGCgACCGGCCGTACGAGCtGTTGCTGCGGCT
GATTGGTGCACGgTGGCTGACCTGCTGGTGgTGGTACGACTGCTGCTGCTGAGGCTGCTGgTGGTaCAAATGCATCGGCTGCTGCTGCtGTTGCTGCTGC
TGCTGcTGcgaGAAGCCTCCCGACGACATGCCGTATGCAGATGCATTCGTGAGTCCGCTGCTGTACGTCGACGCCGAAGAGGACGGCCCCGTCGTCCACG
AtGTTTGCTGCTGCATCGATGCTGGACGCGCACTCGAGCCGTACGACTCCCCCGCCGAGTAGCGGTAGTTAGTGCTCGACGCATTGCTGCCATAGCCGCC
GTACGCTTGTTGCTGCTGATGGAGAGCAGCTTGAGACTCGGCGTAGtAGTAAGCAGCAGCAGACGCGTTCGtACTTCCTCCCAGCATCTCCTGGCTGCTT
GTCGAAGACCACTCGTCGTCGGTGTCCACTGCTGGTGGGCTGTGCAGCAAGTAGCTGTACGCCGCcGATtGctGGTTGCTCATCGCAGACGCCGCCTCCT
TCGCGATGCCACGCTCCGTGTCTCGCGGATCGAGGTCCAGTTCCGGTGGTGGCGATGGCTGGGCCATGACGATACCTGAGCGACTGGCAGCTCCGCTGTC
GTGACGGGCACGCGGTAGGCGGTGCGGTGGCGGCGGGTGGTCATCAAGAGCCATCTTGAGGAACCCACCGCCAAGGGCCTGGCTGGGGGACTGCGATAGA
AACATCTCGATGCTGTTCTTGCGTCGGCTATGCTGCTGCGGAAGCATGCGAGGGCGCGAGCTCAGCGACGCGCTACGGGCACCAAGAGGCGGAGGCGGCG
CTAGCGACGACACGGCATCTTCCTTTCGCGCGTCGTGGTCGTCGTGCGACGTCTGGTTCGTCGGTGACACCGCACGCGGCGGCAAGATCTCGTTGTTGTC