Description :
From Genome Similarity Track
Location :
Scaffold_796:109- 1438
Sequence
1329 bases(100 bases per row)
CGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGG
ACGCAGCTTGGCTGACCCTCGGCGACGACACCGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCTGCGTCGCGGA
TGCTATGAGATCCAGATCTAGCCCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCCTTGACTGCC
ACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTTAGGATCTGCATGACAGGACCTTGATGCAGGA
AGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCAT
CTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTCGTTTCTTCGACTAGCGGGGTTGGGTTTAGGTACAGTGTTGGCTTAACCGGTAAATCTGCA
AATGCATACCGTTTCGCCTTCACTTTTCCTTGTTTTGTTAGCGGATCTTGACGCAAGTCAAGATCCGCAGGGGGTCCCCGAAGGAATCTGGGGAGGATAG
AGAGGTTTCTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGTCAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCA
GCGTCTTCGTCGATCCGACTTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATGCCGAGTCACCAAA
AGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGA
GGGGGTTCCCCGATGATCCGTGTTCTGCTGAACTATCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTGCTCTCTCGGTAACTTCCGAAGAGTTCAA
GTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGCAGTGGAAAATCTTCACTCTGTGTCCGTGGATAGTTCTGAATCCTAAGCGAATATTC
GAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGACCGTAAGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTTGCATTTCCTTTGCGTCGTACTTGCCGC
CTCCTGTAACGGAATCTTGAGAGTTGAGA