Description :
From Genome Similarity Track
Location :
Scaffold_1068:109- 1431
Transcript NameFunction/comments
Phypl_g12246hypothetical protein PHYSODRAFT_466670

Sequence
1322 bases(100 bases per row)
GCCCCAACATCACCAATAGCTCGAAGTACATGGCCTTGTTCTGGAGAGTGGACACCGTTGAGCTCCAAGTCGCCGTTGCACCGCTCGGCACGTTCACTTG
GTCGATGCTTTCGCCAGCGGAGTGAATTACCACAGTGACATCCTCTGTATCCGAGCTTTCAAAGACAACATTGACGATGCCGTCTCCAGCGTGCGTCCAG
ATGCCATTACTACCTGCAAATGCATCGCCCTCAGTGGTGAGTGCAAGTGCGTGTGGCAGGGGTCCATcatcgatctcgtccacAAAGGCAGTGGGGCCGC
AAATGGATTGAACGTACTTCCCGAACATGGAGGCAATCCCCGTAGGATCAAACATGGCGATGATGTCCAGGCCCATGTCGGCCACCTTGGCAATGTAGTT
GACCACCGATATAACCTtgtcatcctcgtcgtccgccaaGTCGATGAGGTCGTCCGTGATAATACTGAGCGCCGTTCAGATCTGGTCACGAACTGTGTAG
GCGTCATTCGTGATGTTCTTGATGCAATTGTTCGTCACTATTGGGATTTCGCGAAGAAAAGGCTCCGAGCTGCTGAGAGCTGCTCGGATCCCACTAGCAG
TCGACTCCGCGTCGGCCTCTTTGATTGTAGCCACCGCGTGAGAAACCTTATTGATGACGGATTGCAACTCCGTACCGCAGGTTCTGCCCGCCTTGATGAC
GTTCAGGAGCGCCTGGGTATCGTCAGTTGCAAGCGCTGCTACGGattcgccagcaccaaccgCCTTGATGAAGGTCATGAATGTGTCGACGCTCAGAAGT
GGCGAACCTTGTTCCACCACGGCGATGAGCACTTTGTCGACAACGCTCACAATGCGAGCAGCTACATTCATGAAGTCTGTGGGCACGTCTAGACGAGGCA
GACGCTCACTGCAGTGGGGAGATCCCGGATGATGATGTTGGAGTGGTTTAGCAGCGAAATGATCTGCACCTGAGTGGAGTTCGGGTAGCTCGTCTGTAGC
TGGTCCACATACGACACAGCATCTCCAACCGTGGCGAAAAGCTTTTGGCCGCATTTTACCCCTTGCTGGACGCCTGCACTTGCCGAACTGAGCTGGCCAA
ACACGCCCGATCTCGCGGATTTCAGGGCAGCGTTGGCCATCGCTTGGATGTTCCCGATGACGTGGAGAACACAGTCACCGCTTTGCTGGATGCATTCCAG
GCCACACTCGACGGGATAGTTCAGGGGGCACTCTGCACGACAGGCGCCAACGTTGTCGAAGTCGTAACCCACGCAGCAATCGGTGGAGATGCAAGTCTTG
CGATAGCAACCGCTGTCAGTCG