Description :
From Genome Similarity Track
Location :
Scaffold_4370:109- 1225
Sequence
1116 bases(100 bases per row)
CGGAAGATGAGCAAGTCTGTTACCATGAAGGCGGGGATCTACACGCCGAGGATCTGGGAGAAGGCATGGCGGTAATCCCCGAGGTACCACTGACCACAGA
AGAAGTCACGATTGATGATATCCAAGTGGATCCGGGGGCGAATGAACCTGCTGAAGTGGATCGTCTGCGTCAGAAAATCTGGGAGAGCCGACATCTGCTG
ATTGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAGAGGGTGCGGAAGGTGG
CCCCTCAGTTCCGAGAAAAACTATCGGATCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCAGTTTCTCAACGTCCCCGTGGGCATCCCCAGTGGTAAT
CATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGCTGGTTAACGGTCTGACTCGATTGATGGTGTATCCGATGCCTCTAAGCAAT
GAGCTGTTGGAAGATTTGGATAAAGTACTCTGGTACTGCTCTCTTGACATGGCCAGCGGTTTTTGGGTAGTTACTATGACGGATCGAGCTCGCGCGATAT
CCGCATTCATCACACCGTTTGGACTGTTCGAGTGGAACCGGATGCCGTTTGGATTGAAGAACGCACTCCAGATCTACCAACGTCTAATCGATAACGCTCT
CTATGGATTCACCCGAATACCGGAACCCAAAAAGGGTGGATCCGGGGAAGATCATACGGAAGTAGATCCATTTGAGGCAGGAGAGCCAGGGGATCCTGGA
ACCCCGTCCGTGTTAGGACGCAGATCTTACATCGACGACATTCTAATCCCGGCGAAATCGTGGGATCAGTTGTGCGAAAGAGTGACATTCCTACTGGAGG
CGTGTACTAAGTGGAATATCTCTATCAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGATTACTTAGGCCATCGAGTTTCCAAGGAGGGACTGGA
GGCGAATCCTAAAGACCTGTCTTCGTTGGCAGACTTGTCCTTCCCACAGTCGCTACGGCGATGCAATCCTTCTTCGGCAGTTTGAACTACTACAGTCGGT
TCATCGAGGATTACGC