Description :
From Genome Similarity Track
Location :
contig_76:108995- 110880
Transcript NameFunction/comments
g12431.t1RAW40538.1 hypothetical protein PC110_g3264 [Phytophthora cactorum

Sequence
1885 bases(100 bases per row)
CTCCATGCGCAGGCGGTCGACCTCTTTCTGGAGCCCGCTTCTTGATTCCAGAAGACTCGTTTTCTCACTGACCAGCGACTGCACGAGCGCCTTTGCCTTC
TGACGTTTGTCAGCGTTTTCCTTGTTGATGGTCTCGATCGATGCCGCTAGCTCTTGATTCTTCTTATCCAGTTGCGCGCAACGTGTTTGCAGCTCCTTCC
GAGTCTCTTCGGCTTTCTGGAACTCGGCATTGACCGACTCGGAGCGTTGGCGGTGCTCCGTGGTGTCCGATTTCAGCGTGCTGTGCTGCGCCTGAAGCTC
AGCCATTTCCATGCTCCACTTCTTCATCTCGGCCTTCAGCGTGGACACCTCGATCTCCTTTTCGGAGATCTTCTCGTTGAGTGTCAAGTTTTGCTTCATC
ATGTCATCGAGACGCTCCTGAGAGGCCACGAACTGCTGCCTGATAGTTTGCATCTCGCCGAGCTGCGACTGGGTCTCTGCGATCAAGCTGTCGCTGCGGC
TTCTGCCAAGGTTGACCTTCTCGTACAGCTGGGTGATCTCCGCGAGCTTGTCCTCCAGCTCCGAGCATTTGCTACACGAATACGACGCTACCTCATCGCA
CTTGGCTTGCAGCTGACTCTGAAGCGAGGCAATATCCGCTTGAGTTTGGAGCACCTTTGATTCGCTGTCATCCGCTCGGCGGCGGTAGTTGTCCAGCTGC
TCAAGCTGGAAATCTTTATCCGATAGCTGCTTCTGGAGGTGTTGGTTCTCGATCTTGTGCTGCTCAAGTTGGTATTCCAGCTCCTTGATCTTGGTGTGGT
CAGCCTCCAGCAGACTGTTCTCGTCGGTTTTCATTTGGGTCTGCTGAGAACTGAGCGCAGTTTCAAGCGAGCTTTCACGAGCTTTCAAGGAGTCAACTTC
CTCGTGCAGGCGACTGCGCTGTTGCTCCGCCGCGACACGAAGCGCTTCCATGTCCTGGCGGAGGCTCGCAACTTGCTGGGACGACTGCGAAGCCTCTGCT
TCTATGCTGCGAAGACGTTCGCGCAAATCTGCCATCTCGAAGTTCGCCGAGTTTAACTGAGTCTGCAGTGCATTAAACTCGTCGTCAGTGTGGGAGCCTG
CAGCCACTGGTTGGGACAGGAAATCCATCTCCTTAGCCTGGTCAGCAGCGGCCCTGGCAGCTTCTGCAGCCGCAAGAGCTTCAGCCTTTTGCTGCAGCTG
GGTCTCAAGGTTGCGGCTTTTCTCTTTCTCAACTTCGAGCTGCGAGTTCATCGCGTCTGCGAAGGACTTGGCACGCGTCTTGAGGTCGGTCTCGCGCGCC
GCGGTCTCTTTCTTCAGCCTCTCAATTTCCTCGGACAGACGCTGATGCTCTGCCGAGCCAGAGTCTGCAGGTGGAGCAGCCGAGACTGCAGCGGTTGTTG
CCTCCTTCAGCTTTTCCTCCAAAGCCGTGACTTTCTTCGTCTCGGTCGCAAGTTGGCCGCGCATGTTGTCCACGAACGCCTTGGTCTTGGCCTTGAGAGC
GTTCAGAGCCTCCTCTTTCGCGTGCACCTCGCCCTTCAACCGCGCAACCTCAGCGGCCGCATCCGGTGGTGCCGCGGCTGCTGTCGGATCCATCGCTTCT
TCGTTGCTTTTTGGTCGCGCTTAGCTCGTGTGGGATGGAGAACTGGTTGGTGGCGGGTTCAGAACTTGCTCAGCCATTGACCGCGCGACAGAAATACACC
GCAGGCATGACAGTAATCTGATCCCAAGGCAGGAAGGACTCTTTTAGCGTGCGCCATGATGTACTAGGCGGTGTAGTGGAAGTGCCGCATCCATCCTCTG
TCGCTACCCCATTTTTAGCGGGCACCTCGTCCTCACCGTTGCATGCCGTTCCTCAACTATGGGACCATCACTCTCGTTCGCAAAT