Description :
From Genome Similarity Track
Location :
Scaffold_438:10898- 14140
Sequence
3242 bases(100 bases per row)
ATAAGCCGCATGGATTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAC
ACGGCACAAGTGGAAACGATTGCTAGATTGTTTTATAATACAGTATGGAGGTCAAGGTGTGTCAGTAGCCAGACAGTATTACCTCGCACGGAAGCGATCC
GATGAAACCCCGCTGGGGTACTTGCATCGTCTTAATGTCGCGGCCACGCATGCCAAGAACGCGATTAAAGAAGAAAGACTGGCTACATCGGCCACAAGTC
GCGAGCATGTGGAACACTTCATTGCTACGATGGACGATCGCGATCTGGCAAAACAGCTGACCTTACTGCTATTGATGGATATTGATGAGATGGAAGAAAC
TCTCCGTGCGTGTCAACGGATGGAGAATCGTCAGATGAAATTGTCGATGGGATCAAACAAATTCCATCAGCGATCGGTCGCACCTGCAAATCCGATGGCG
TCCAAGACAACTCGGGCGGTGCGAGCGATCCGCGAGAAAGTCGAGAGCAGCGGATCGGAATCGGAGTCGATTGGATCCGAGGAAGAACTGGATCGTCGTC
GTGTTTGTGTAACAACTACACCCGACCAAGAAAAACCGAACAAGGATCATCGCACCTGGCAGAAAAACACTGGTGAAGGGGAGGGACGCGATCGTAGTGG
ACGATCGAAGGCGTGCACCCATTGTGGATCTACCAGACACGATGATCGAGGGTGCTGAAAGAGATTGACGTGCCAGAAATGTGGTCGCAAAGGAAACCCC
TCTGACAAATGTTTCTTCGTTTGTGCAGCCTGCGGGGATATACACGAGAGTGGCAAGTGTTCCATGGAAGAATTTTTCAATTTGGTCCGAAAGTGGTACG
TGTCTACGAAGCATGCTGGAATGTTTCCGCCCAAGGTGGAGGAGATGTTAAACTAGAACGCTCGCCAGGTTGGAATATGGCACGAGCCGAGCGTTCTAGG
CTTTGCCTTTTTATGCATTTGTAGAAGGACCACGGAGAGATCAAGAGGTTAACGATCGGATCGATCCGATCGCTAACATACATAAAGATCTTACACTGGT
CTCGTCAATATCAAGTGTGAAAAGAGTGGATGATTACGCCCGATCTCCTGTGAGCATGGAGCTCGACCTCGCGCCAGGGGAATCGTGCGGGTATTGGAAA
TACCACACACCTGGAAAATGGTTTAAGCAAGCAAAAGCGGTG