Description :
From Genome Similarity Track
Location :
Scaffold_1098:10897- 13822
Transcript NameFunction/comments
Phyta_totarag12034hypothetical protein PHYSODRAFT_261959
Phyta_totarag12035hypothetical protein PHYSODRAFT_534075

Sequence
2925 bases(100 bases per row)
CGCCGAAGGTGGACCCTACAACCATGCGGTTGATCGTGTGCCCGTTGTTTGCCACGACGTCAAATCGACCAGAACGCACCACGTAGAACTTGTCGCCGAT
CTCACCCTCAGTGATGACGGTCTCTCCAGCCTTCACCACCTGCACGAACATACACTTGGCCAGcgactgaagctgctcaGTCTGCATGCAGGAAAATATC
ACGTTGTCCCTGAGTGCCGccacaacagcttcttgttccTCCGGCAGCAACTGGGGGCCATCGGCAACACCTCCTTGCTGGatcagcagcgtcacttCTT
CGCTGTCCGCCACATCGAAGCCAGCGGAGTCGCGGATGTTCGGTCGACGAAAGCGAACCATCTCAGACAGCACCCCCTCGTGAACTTGAGCCACACTCGG
CGTCTTTGCAAATTGTACGGACTGAGAGGAGGCACTGCGTGATGCCTCACTTGCATCGGCATTCTCATGAGCCAGATGCCGTTGCACGGAGCTTACGCAG
CCCATTTTCAGCTCTGAAAGGACGAAAGGTGTTGAAACAAAAGCGTCCGCAGTGCTTGTCAAGCTTGGAATTCACGGTTGactggatggagctggaaaTT
CGGCAATGGCCATCGTGGTTCACCGAGCTTTAGCCCACGAACCATCGTTATCAAAGCTCTCAAGCTATTGACGAGCTCAACTCTGATCCGTTTCGTGCGT
GTGCCCTATTTCAGGGGGGGTGGTTAGTGATGAAAGTGTCGGCGGCATCGCATTGCTAAGTGCCCCGTCGCATTCAACCTTGGCCGTTCCGATCAAACCA
GCGACTGCGTATCTCCCGAGAAGTTCTGGACGTCATGCACCGTCTGGGCGTTCGGCACGCGGAGGTGGCCGTGATCAGTGACGAGCTGATCAAGAAGGTG
GCCTGCGCAGATTTGGACCCCGCCAACAACAACGCGATCAATGAGGCCGACCAGAGTGTGGACTTCATCAAGCTCCAGACGCTGTCGATGTCGTTCCAGA
ACATCTTCAAGATGGAAAACCTCGAGACGCTGCGCCAcctcgtgaagctgcagctggacaaCAACGTGCTCCAAGAGATCGACGGGATCGGTCACCTCGT
GCATCTCGAGTGGCTTGATCTCTCCTTCAACAACATCTCCTCTGTCAAGGGGTTGGAAAATCTCGTGAAACTCACGGACTTGAGTCTTTACAACAACTGC
ATCTCCAAACTCGAGAACCTCGACACTCTCAAGGAGCTTCAGGTAGGCAGAGATCGTCTTCGCTTTGTCCGATCGACTTCGGCTTACGTGCTGGCTTATG
TGTGGGCAGGTCCTATCGATAGGTAACAACCAGTTGCCGTCCACGGAAGGACTGCTGTACTTGAAGTGtctcgagaagctgcgcgtgctcAACTTGAATG
GAAATCCGGTGTGCTCTGACCCGGAATATCGGCCGTGAGTTTCTATTGTGGAGATTTTTACCCGTTCATGGGGAACTAACTGACAGCGCTGGATGATTTA
CTTGTCGTGTGCAGATTCCTGCTGGCTCATCTGGAAAAACTCCAGTATCTGGACTACGCCCTCGTTGACGAGAACGAAACAGTCCAAGCACGCGAGCAGT
ACCAGGAcgagttggaggagctgaaggaagtGAAGGCAATCGAAGACGCCGCTCTGGCGCGAGAAGCGGAGCAACAGAGATACTTGGGCATGCTCAAGGA
CGCGAATGTGATCATCCTTGAGGTGTGTACAGTACCTCCTCACTGCTTCATTGTGCTGGGATCTTACCTCGTTTATTTGCTTGCTAGACTTTGTTGACTG
ACATGTTCAAGGAGGACACCGAGATGAACAAGATCGAAGTGTTGCCAGGACTGTGCAACATCATTGACGATTACAGCGAGAAGGCTAaggcagctgcaga
agacgtAAAACTGGTTCTGCTGGAAAAGCACTCGGCGTTGACGAAGGAGGTGGGCGGGTTCAAGGCGACGTATGAGAAGCTCCAAGCcgacgctcaagaa
gcaagCATTCGGGCAGTGGAAACACATCGTCGTACGGCCAAACAACTTTTGAAGCAAGCGGCCGCTGCTCACAGCTCTTCAGCCTCGGATGCTGATGGAT
CGGCAGTGGgtctgcaacttcttcatgaCGCCGAGATTTCAAGCGAAAAGCTGCACAATGAGCTCATGAACCTTGAGTCGGACGTGGTGGAAACAGCACA
GGAGTTGATCGCTGATATGGAAAGCTCCATCGAGGCGGTAGGCTCGGAGGCACGAGATGTCGCAACTGAGCACTTCCGAACAATTGAAGTTCTCGAGAac
aacttcttcgagaacGTCAGCCAGCTCGCGGTAACGTTACTCGAGAGAATGGCATCtgacgacggcgaggacgacgatTACTTGACGGACGAGTGCCGCG
CCATCCTGAACGACCGAGACGCGCTGAACAATGCCATCAATGGGTCCCACGATATCCACATTGGCAAGCTGCTTGCTCAGGAGGATGCCATGCGTGAACA
AAGTCTCGCGAAGGTGGCTGAGATcgtcaagaacgccaaggaGCAGGAGTGGTCTCGTAACCGTGCTCGCATTGCCGAGGTGTTGCATCTGAAGGAGAAA
CACTTGGGCGACATCAATCGTGTACGTGACGAGATCAACCGCGTTGACGAGGAGTTCTACTAGAACCTGGTAAATAAGCATAGCAACCGTAGCAAAAAGT
GAGACCTCAATGAATTCGAACCGAGTGAGTTGATTCCGTTAGCAACGCAGACATGGTGTTCAACCACACCAACATATCtgatctgctgcagtgtgTCGTA
GACGATGAAAattggaagaagagcaacgCAGGCACGGCTTTGGCTCTCTTCTGTCGACTCACATGGTTGTGAAGCCGTGAATCTCACCTGATGCCATCCA
GGGGGACGTCGAACTCTTTGGCGAA