Description :
From Genome Similarity Track
Location :
Scaffold_31:108969- 110207
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_07785Hypothetical protein

Sequence
1238 bases(100 bases per row)
GCCCAGAGGCCAAACCCATGGAAGAAATACGGGCTGGACGCCATGTAGGGCTGGCGAAACGTCGCGCTCACGTCGTACTGCTCGGCCACCTACACCTTGA
CGCTAGGGGTCCGAACGTAAGAGTACTAAGTACCGGCGCGCCAATGAGACCGGCCGACGACGGCGGGTAGCTAAAGATGCGCGCCGCCAGCGACACGACG
CGTGCGTACCACGACTGGTACATCTCTCTACACGCGACGCACATGCATACGATGGAAGTGGGATGAGAACTACGCACCGCCGCGCCTCCACGGGCAGTGT
CAAGAGCCGAAGCACGATCGAGTCGAGCGTCTGCTGCCCGTTCGGGTTGACTTCCCACTGCCCCGAGACAAACGAGTCACCAATCGCGACGAGCCCGTCG
CTCATCCAGTCGAGCCAGAACGCATGGTCTTGCACGACAATGTCCTGCAGAAAAATGACATCGTGCCAGGATATGGCAAGCAAAGGGAAAGCGTACCCAC
GGCGTATCCGGAACGGTCGTCGTTGCATCATCGGGGTTGGCGACTTGGATCTCGCCGTGCTGGAGCAGGCGGTGCATGATGGTGGCGGCCGCACCGCGGA
TCTTGGGCAGGAGAAGCGACCGCAGCACTTGCATTGTCATGACCATGGCGCCAATGAGCAGCGTCAGCGAGTACATAAAGAACGAGCGCTAGCACAAGTG
TTGCAGTCGAGAAGCGTATCGATCCACCTTACGGCGCAGACGAGGCAGGCCAAGAGCGGGATGCTCGTACACAAGAGCAGCTCCATCTTGTAGAGCGCGG
CCCAAAACTGCGGCGGCCGTGGCGGCGTAAACTCGTACGGAAGGTACCTAGCTCACGACATCAGAGGCGCCACGCACAAGGATAACGATGTACAGGCGCG
ACACGATGGCAGGCATCGGCACACTCGGGTGATGCACGACGTAGACCAAGCCCAGCGACACGGGGCTCATCCAGAGCTGAATCGCGTCCAAGTACTTGAC
GAGCAGATAGCACGGAAGCGCTATGTGGAAGGCGCCGTCGACAAGGCGAAGGGCCACGGCGAGCGCCGGCGACGACGCCCAGACGCCGACCTCGGCGTGC
AAAAGAGCCGTGAAGGCGTACCGGTCGAGCGTCCGGAGGCTGTACCACGTGATCATAAAGGCGACGCCTAGCGACGCCATGAGGCCAAGCCCAGCGGCCG
AGCCTGTCGCGTACGCGGTCGCCGTGGCCGCGACCCAG