Description :
From Genome Similarity Track
Location :
scaffold_76:108960- 110851
Transcript NameFunction/comments
g7368.t1 sporangia induced hypothetical protein

Sequence
1891 bases(100 bases per row)
GTCTTCGATTTCACGCTTCGCCGCAGCGAGATCCTTTGCGCGCTGTTGAACCTTCTCAGACTCCTGAACGGTAGTGAGGGCGTGCTTCAATGAGGCGACT
TCATCGGTGAGACTCTGAACTGTTGCAGCGGTTTGAGACACCTTTTCGTTGTTTTCATCCCGAAGCTGCTTCACTTGCTGGTCGTTCTCGACATTGCGCT
GGTTCACCTCCATGCGCAGGCGGTCGACCTCTTTCTGGAGCCCGCTTCTTGATTCCAGAAGACTCGTTTTCTCACTGACCAGCGACTGCACGAGCGCCTT
TGCCTTCTGACGTTTGTCAGCGTTTTCCTTGTTGATGGTCTCGATCGATGCCGCTAGCTCTTGATTCTTCTTATCCAGTTGCGCGCAACGTGTTTGCAGC
TCCTTCCGAGTCTCTTCGGCTTTCTGGAACTCGGCATTGACCGACTCGGAGCGTTGGCGGTGCTCCGTGGTGTCCGATTTCAGCGTGCTGTGCTGCGCCT
GAAGCTCAGCCATTTCCATGCTCCACTTCTTCATCTCGGCCTTCAGCGTGGACACCTCGATCTCCTTTTCGGAGATCTTCTCGTTGAGTGTCAAGTTTTG
CTTCATCATGTCATCGAGACGCTCCTGAGAGGCCACGAACTGCTGCCTGATAGTTTGCATCTCGCCGAGCTGCGACTGGGTCTCTGCGATCAAGCTGTCG
CTGCGGCTTCTGCCAAGGTTGACCTTCTCGTACAGCTGGGTGATCTCCGCGAGCTTGTCCTCCAGCTCCGAGCATTTGCTACACGAATACGACGCTACCT
CATCGCACTTGGCTTGCAGCTGACTCTGAAGCGAGGCAATATCCGCTTGAGTTTGGAGCACCTTTGATTCGCTGTCATCCGCTCGGCGGCGGTAGTTGTC
CAGCTGCTCAAGCTGGAAATCTTTATCCGATAGCTGCTTCTGGAGGTGTTGGTTCTCGATCTTGTGCTGCTCAAGTTGGTATTCCAGCTCCTTGATCTTG
GTGTGGTCAGCCTCCAGCAGACTGTTCTCGTCGGTTTTCATTTGGGTCTGCTGAGAACTGAGCGCAGTTTCAAGCGAGCTTTCACGAGCTTTCAAGGAGT
CAACTTCCTCGTGCAGGCGACTGCGCTGTTGCTCCGCCGCGACACGAAGCGCTTCCATGTCCTGGCGGAGGCTCGCAACTTGCTGGGACGACTGCGAAGC
CTCTGCTTCTATGCTGCGAAGACGTTCGCGCAAATCTGCCATCTCGAAGTTCGCCGAGTTTAACTGAGTCTGCAGTGCATTAAACTCGTCGTCAGTGTGG
GAGCCTGCAGCCACTGGTTGGGACAGGAAATCCATCTCCTTAGCCTGGTCAGCAGCGGCCCTGGCAGCTTCTGCAGCCGCAAGAGCTTCAGCCTTTTGCT
GCAGCTGGGTCTCAAGGTTGCGGCTTTTCTCTTTCTCAACTTCGAGCTGCGAGTTCATCGCGTCTGCGAAGGACTTGGCACGCGTCTTGAGGTCGGTCTC
GCGCGCCGCGGTCTCTTTCTTCAGCCTCTCAATTTCCTCGGACAGACGCTGATGCTCTGCCGAGCCAGAGTCTGCAGGTGGAGCAGCCGAGACTGCAGCG
GTTGTTGCCTCCTTCAGCTTTTCCTCCAAAGCCGTGACTTTCTTCGTCTCGGTCGCAAGTTGGCCGCGCATGTTGTCCACGAACGCCTTGGTCTTGGCCT
TGAGAGCGTTCAGAGCCTCCTCTTTCGCGTGCACCTCGCCCTTCAACCGCGCAACCTCAGCGGCCGCATCCGGTGGTGCCGCGGCTGCTGTCGGATCCAT
CGCTTCTTCGTTGCTTTTTGGTCGCGCTTAGCTCGTGTGGGATGGAGAACTGGTTGGTGGCGGGTTCAGAACTTGCTCAGCCATTGACCGC