Description :
From Genome Similarity Track
Location :
contig_57:108932- 110844
Transcript NameFunction/comments
g8901.t1hypothetical protein

Sequence
1912 bases(100 bases per row)
CTGGTCGTGGTGATAAATGCTCTGCCACCGTAAATCGCCTCCCATGCCGTTTCATATCGTGGCTCGGGGTGGAGGTCGGCTCTCGTGAGGTAGTGTTGAC
CGCGCTGACGATCAAGCTTCTCCTCTGGCCTTCGGCGGTGAGTGCAAGCATCAGAATGAGCACAGTGTTCTCGTCGTTGCCCTCGTAGATCATATATGTA
ATAGATCGGAACAGAGTGCTGCGGGTGGGCACGTACTTTTCTAAATCTGTGCGCACCAGCTAAACCTATGTTTTGGCGTCCCAGAATAACTGCGGGAATC
GCTCCAATGTTGACAGTTGTTTTCAAAATAATGGTCACTTTTGAGGCTTTAGCCGTACGTTTTACTAGTATTCTGCAAATTGATTGAGAGCCATCTGAAG
CTGGTAGAGCGCTTGGGCTGCCGTTGGGCGAGCTGCCGGATCCCTTGATACGCATGCCATCCCGAGCTCCACTATCACCATTGGACAAGAATCGGAAAAT
TCTACGTTCAGCTTGCCCTGCATCACGAGCCGCAGAACCGCCAAGTCGGACTTCGGACGACCCCTTTCTGCGTTTCTTGCATACGGCAGCGCGTGCGAGT
CGAGCTCCGAGAGAACCACACCGAAGGAAAATATATCGGCCTTCTCGTCGTACTTCTCCCCTGTCATCATCTCGGGCGCCATCCAGAGCGACGTGCCAAC
GCCAGCCGTCATCGTTTGATCAACTCGCGTGCGAGACACCCCAAAGTCGGTCAGCTTGGCATCAAGCTCATGCGTCAGCAAAATGTTCTTGGACTTGAGG
TCGCGGTGCACGATCGGAGGTTCAAGCGAGTGCATATACGTGAGTGCATGTGCGACGTGCAGCGCGATCTTCGCCTTGCTGGGGTCGAAACCAATCGGAC
GTCGCTCGTCCTGGTACCGATTCAAAAGCGCTCTCAGGTCTCCACCCCCATGAACTCTGATACAACGCACAGGTCGGCGAACGAGTCCCAGGCCACGCCA
ATCAACTCGACGATGCGCGGGTGCTCCAGCGTCGCCATCAGCTTCACCTCCGCCAGGAATTCGTTCACATTTTGGATCCGCTTGCGTGTCTCCGCCAACA
GCATCTTGACAGCTACCTGCTGGCCGTTGAACGTTCCCACGTACACTTCGCCGTATCCTCCGCGAGAAATTCGTTCTTGCAGCAACACCTCTCTTGGAAT
ACGAGCCGCAACGATAACCTCGTCGTTCCAAAGACTGGCACCTTCACCCAACTTTCCTGTTTGCTGGCTGGTTCCTGCTGTCATCAATTCCTCGTCGTAG
TCGTTCTTGCTGCCTGATCGACTTGATCGTCTCCTCCAGACAAGCGTCGCTATCAAGCAGATGACAACGATACCCCGACCACAATGGCAGCGATCACTCC
CCCGCTAACCGACGAATCGGACGTGGAGCTGGTGTTCGTTGAGTTTGTGGAGGGCTCCGAGGTGGAGGCTGCACTGGCGCTGTGTGACCCAGCCGCGACG
ATGACAAAATCTGAGCCGGTTGTGCTTGCGTTCGCGTCGCTGCTCATGCTGTTGTAGGTCTCCGAGGCGGTCGTGTAGAACACGAGGCCGTACGAGCTGG
AGTACCCGACAAGGCACGTCCACCCGACATCGGAGCTTGGAATGGACATATCGCTGACCGATTCGGTGCATTCTGTGTCGTCGAACAACTGCAATTCCAG
AGACAAATCTGCGTTTACAACCGCGATGGAGGCCGCATACGAAGTGATGTTGGGGAGAACTCTACACACTCCGTCAGCGTAGAACGCGAGTGCATTCACC
AACGTGTCGCAAGTGTTCGGCGGGGTGTATTGCTCCTGAATCACGTAGGGGGCGTCGACGTCAGCGTAGATGGCGGCCGTCTCTCCACGGTCGTTCTGGT
AACAGTCCACCT