Description :
From Genome Similarity Track
Location :
Scaffold_565:1089- 4058
Transcript NameFunction/comments
Phyra_86254Hypothetical protein

Sequence
2969 bases(100 bases per row)
GGGTCAAAGTACAGCGCATGCCAGCGCTGACGAATCGCAGAAACCACCTTGGTAACGAAAAACTCTTGTACCGCTTTCGTTTCGTTGAAAGGGATCGAAG
CTTGCAGCAACGAGCTACTCAATCTACAGATCATAGAGTAAGTTAGCTATTCCATTGGTGTATACCCCAACATGACAGCACTTACTTTTCATAGTTGACG
TAGAGCTGAAGATTGGTAGCATCGATCAGCATACCGCACCATGAGATGCACTCAGAACCTGGTGCATTGGTTGGAAGCCCCTGAGTAGCTGCAAAATTCG
CTTGGCTCTTGGCAACATTGACAAAACACCCAAATTCCTCGTTGCCCTCGTGCATCACGGCGACGAACCTTCGCGCCCTCTTCAGGTCCGTCGTAATGAA
CATGAAGTCATCGGTGTACCGAAACAGCCCTTCGTGTTGACAGCAAGATACTGGTACGATGGCTGGGTCGCATACCTCAGGCAATCGTTTGCCGAGTACT
CGCCGCTCGAAATGGGCATAGTACATGTTGCACAACGTGGTGGAGAGCACGGAGCCCTGCGGGATGCCGCATCGCTGAACGTAGTCACGGCCATCGACTT
GGACGACGTTCGTAGACAAATGCTCCTTCAGCAGCTCGAGCGCTTTAGCTTTGGTCAGGTAGTCGTACAGGACACCGTCCACAAACATTGCGTTCTCTTT
CTTGGACTGCGCTGCAAGTTCTTCAAACCCCAACAATTCTCCAGACGGATATGCCGGACGCTCCAGCTTGAAGAAAAACGAAGACGAAGGCAGCAATTCA
TCGCTATCTGAGATCGGAGCGACTTGGTGGCCAACCCAATGCTTGCGAATGAGATATTCATCCTCTTGTATCGCCTTCTTGAGAACCTGATACAGTTTCC
GAGGCCGTATGGTATCAAAACAACGCTCCACATCGACAGTCACGCAGTAAGCCTTTGGGGTGCCCTTTGATGCACGTCGACGCTCTTCGCATCGAGAGCA
CGAGGAGATTTCACGGAATAGAGGCTTGATGCGCTTGTAGATTTCATCCACGTTTCGGACGGAGGCCCCAACAAATCGCTTTGGCTGGCGCTCCATCTCG
AACGTCAACACTCGGTGTATGGTTTCCATGGATCTGTTCACTGAGACTTTGCCTTGGTCCACAGCCCTAGATAAATTCATCAGCGGTCGAATTCCACTCG
ATTTCGGGAGCAAGCGCAAACGAGAGGTTGCTAGCTGCCGCTTACGGTTGGCTTGCAGGGTTTTGTCGCTTGATGGTTGAAGAATGCCTCCCTGTAGATC
GTCTAGAGCAAGTGTGCTGCAACATAACAATTCAGCGCTAGCACTTGGCAAGTCGCACCCACAGTAGCTAGCTACCCCACCTGATCACATTCCAGACTGG
ACGCTGATAGAACTCGATCTCATTCGCCACTCCTTCTGCTTCTGTAATGTAAAACAGGTTTCTCAACAATGGGAAGATCAGCGACGATATCACCCACCGC
AGCACGTCTTCAAAAAGCTGTTGACGCTTGACTCGTTCATTTGGAGGGCTGAACATACCACAAATGAATTAGTTGTACCATTTTCAGGAATAATGAAAAC
CCAACACAGTACCAGAACTCCGCATTCGAGTTGGTATTCATCCATTCCACTCTCGTAACTTGAAACTCTTCAGCACACTGCACAACATAGTCAATACAGC
TTCTGTCTTGCATGGCTGAATTGCAGTCACGTACCTTCTTCAGCGAAAATATGTCGAACTTTCGGGAAAAAATGAGCTTGCGCAGCATCGACTTGACATA
CTTCCAGTTCTTCTTTGTGTCGCTGCTGCCCCACAACTCCTTAGGCACAACTCCAGCTAGCAGCTTCCGAACCAGCCGATAAATCTTCTTCTTCGGAGTC
ACAAATGTCAGCATCGTCTTGATATCCTCTTTGTGCTGTTGCAGCTTTGCCACGTCTGACGTTGAGTGCGTACTGACCCGATCTCCTGGGTTGGCCACTG
TCTTCTTAGTCTTCTTCCCCACCGGCGCTGGCATGCCGTTACCAGCTTTCGATGTCCCCACAGAAGCGTGTGACAGCATTTCAATAGCTTCCTCCCTCCG
CTTACGTTTCCGATCGCAGCTCGGAGCCACAACCTCGCTTTGGCTCGAATATCCGTCGTCAAGCGCTTTACGAACGATTGGAAGCAGGATAGGTCTCGAT
GTCGCCTCTGCATTAGCATCAGCAGTTTTCTCCGCAAGCATTCGCTTGATGTTTGGATGACCCGCCATGAACTTACGAAACCCAGCGTGCACTGGGATTA
ACTTCCTTGCGAGCTCTTCAACTTTGAACGCCTTGAATCGTGCCACCATCTCCTGGATCGTTGGAATGAGGTTAATCAGCCGCTTGGGCAAGCGCTTTCC
ACCTGCAGTGTCTGGGAATATGGATCCGAGGACCCGTGAAGCTTCCGTCCGACTAATCGGCTCGCCTGTCTTGGACGCTTTCACTAGAGCGTGGGAGCTC
GCGAACACTCGATCCTTTCGGAAATGCCTCGCATACATCACGTGGTTGATCGACACTCCTCGCTTTAAAGTGGCAGTCGCGTCGCCCAGTCGCTTCTGTT
GTCGAAGACTCTTTCCAGTGAGCTAGCACACCACAAAGCACCACATTAGCCACCACATCCAACCCCCTTCTCAACCAGACAGCACTCTACCTGCATATAC
GACAGCGAGGCTTCCTTCAGTTGCACAACAATCGTGTAGTTCAATAGCAAGTGCGTCAGGAGGTCGTCCCCCATGAGCCGATGCAGAGATTCCCACAGCG
GCTTCTTCAGAGCAGCCACGAGAGTGTTCGGGTAGTAGCACATGACCCCATTGGACTGCGCCACTCGGTGGCCAGTAGCCCCGGGCGTCACTTCCCGATA
CCCGAGGGTTAAAACGTTGGCGTCCTCCCAATTCTCCACCCGTTTCCGAGCCAGAAGCCGCTCGATGAC