Description :
From Genome Similarity Track
Location :
Scaffold_1344:1089- 2151
Transcript NameFunction/comments
g16790.t1hypothetical protein

Sequence
1062 bases(100 bases per row)
GACGAGTACTTTGCGAGTCGCACCATCCTCACCACCACGAACGCGATAGTCCATCTTATCAACGAAGCCGTAGCGGATCGCATGACTGGACCAGCTCGAG
AATATGTGTCCACAGACTCAGTTGAGGATGACGAGGACGGGAACATATTCGAGCAGGAGGTGCTCAACTCCCTGAACATCAGTGGCATCCCACCCCACAA
ATTGAAACTCAAGAAGGGGATGCCGATCATCATGATGCGGAACTTAAATCCCGACCTGGGGTTGTGCAACGGAACGCGCCTGCGAATCGGCGAGCTCAAA
GATCATGTCATCCACGCCACCATGGCGGGCGACAGGCAAGGCCAGCATGTGTTGATCCCGCGCATCGTGTTCATCAGCGATGGCGACATCCGCGATTTCC
CATTTCGACTGAGACGCAGGCAGTTTCCTATCCAGACTGCCTTTGCCATGACGATCAACAAGGCGCAGGGACAAACGGTGCAGTACCTGGGACTGTACTT
GGCGACTCCTTGCTTTTCCCACGGTCAGCTGTATGTGGCCATGTCAAGGGTTACGTCGAGATCGAGATTCAAGGCGTTGGTCGAGTATCCAGAGCGGGAG
GAAGAAGACGGAGTGTACACGGCGAATATAGTGTACCGACAGCTGTTCGAGAGGGCGTAGGCAGTGACTTCGTGTGAATGCATATTTTACGAAAGGAATA
CATTTGTCACTTTGCATAGCGGTAATTGTTGAGAGTCACCATTCCCCCTCGAGCGCAGCGAGTATGCCTGTGGTTTGAAGCCCGTGTGCGAAGCACGCGG
GTGCAAACCCAGGACCAAGCAGTGCATGGTAGACAAGCGGAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTCGTACACACGGGAACCACGTGAGAC
GAGCGCAGCGAGTACGCCTGCGGTTTGAACCCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAACAGTGCATGGTAGACAAGCGAAGGCGAAGCT
TGCGAGCCGCAGCGGGCTTAGGGTTCATGGAGACGGGAACCACGTGAGACGAGCGCAGCGAG