Description :
From Genome Similarity Track
Location :
contig_76:108874- 110759
Transcript NameFunction/comments
g10070.t1sporangia induced hypothetical protein

Sequence
1885 bases(100 bases per row)
AGCCCGCTTCTTGATTCCAGAAGACTCGTTTTCTCACTGACCAGCGACTGCACGAGCGCCTTTGCCTTCTGACGTTTGTCAGCGTTTTCCTTGTTGATGG
TCTCGATCGATGCCGCTAGCTCTTGATTCTTCTTATCCAGTTGCGCGCAACGTGTTTGCAGCTCCTTCCGAGTCTCTTCGGCTTTCTGGAACTCGGCATT
GACCGACTCGGAGCGTTGGCGGTGCTCCGTGGTGTCCGATTTCAGCGTGCTGTGCTGCGCCTGAAGCTCAGCCATTTCCATGCTCCACTTCTTCATCTCG
GCCTTCAGCGTGGACACCTCGATCTCCTTCTCGGAGATCTTCTCGTTGAGTGTCAAGTTTTGCTTCATCATGTCATCGAGACGCTCCTGAGAGGCCACGA
ACTGCTGCCTGATAGTTTGCATCTCGCCGAGCTGCGACTGGGTCTCTGCGATCAAGCTGTCGCTGCGGCTTCTGCCAAGGTTGACCTTCTCGTACAGCTG
GGTGATCTCCGCGAGCTTGTCCTCCAGCTCCGAGCATTTGCTACACGAATACGACGCTACCTCATCGCACTTGGCTTGCAGCTGACTCTGAAGCGAGGCA
ATATCCGCTTGAGTTTGGAGCACCTTTGATTCGCTGTCATCCGCTCGGCGGCGGTAGTTGTCCAGCTGCTCAAGCTGGAAATCTTTATCCGATAGCTGCT
TCTGGAGGTGTTGGTTCTCGATCTTGTGCTGCTCAAGTTGGTATTCCAGCTCCTTGATCTTGGTGTGGTCAGCCTCCAGCAGACTGTTCTCGTCGGTTTT
CATTTGGGTCTGCTGAGAACTGAGCGCAGTTTCAAGCGAGCTTTCACGAGCTTTCAAGGAGTCAACTTCCTCTTGCAGGCGACTGCGCTGTTGCTCCGCC
GCGACACGAAGCGCTTCCATGTCCTGACGGAGGCTCGCAACTTGCTGGGATGACTGTGAAGCCTCTGCTTCTATGCTGCGAAGACGTTCGCGCAAATCTG
CCATCTCGAAGTTCGCCGAATTTAACTGAGCCTGCAGTGCATTAAACTCGTCGTCAGTGTGGGAGCCTGCAGCTACTGGTTGGGACAGGAAATCCATCTC
CTTAGCCTGGTCAGCAGCGGCCCTGGCAGCTTCTGCAGCCGCAAGAGCTTCAGCCTTTTGCTGCAGCTGGGTCTCAAGGTTGCGGCTTTTCTCTTTCTCA
ACTTCGAGCTGCGAGTTCATCGCGTCTGCGAAGGACTTGGCACGCGTCTTGAGGTCGGTCTCGCGCGCCGCGGTCTCTTTCTTCAGCCTCTCAATTTCCT
CGGACAGACGCTGATGCTCTGCCGAGCCAGAGTCTGCAGGTGCAGCAGCCGAGACTGCAGCGGTTGTTGCCTCCTTCAGCTTTTCCTCCAAAGCCGTGAC
TTTCTTCGTCTCGGTCGCAAGTTGGCCGCGCATGTTGTCCACGAACGCCTTGGTCTTGGCCTTGAGAGCGTTCAGAGCCTCCTCTTTCGCGTGCACCTCG
CCCTTCAACCGCGCAACCTCAGCGGCTGCATCCGGTGGTGCCGCGGCTGCTGTCGGATCCATCGCTTCTTCGTTGCTTTTTGGTCGCGCTTAGCTCGTGT
GGGATGGAGAACTGGTTGGTGGCGGGTTTAGAACTTGCTCAGCCATTGACCGCGCGACAGAAATACACCGCAGGCATGACAGTAATCTGATCCCAAGGCA
GGAAGGACTCTTTTAGCGTGCGCCATGATGTACTAGGCGGTGTAGTGGAAGTGCCGCATCCATCCTCTGTCGCTACCCCATTTTTAGCGGGCACCTCGTC
CTCACCGTTGCATGCCGTTCCTCAACTATGAGACCATCACTCTCGTTCGCAAATTGAAGTCATTATTTCAAGGTGTCCATTTTAA