Description :
From Genome Similarity Track
Location :
Scaffold_3:108871- 110037
Transcript NameFunction/comments
Physo_127821hypothetical protein

Sequence
1166 bases(100 bases per row)
TGCCCAAGGATCCGTGCCACTGGATTCTCCGAGACCGAGATCTCAAGATCTCGCTGGCTGACCAACTTTTCACCCTGGACGACTAAGAACTAGTTCACAC
GCAATGGGCCACCCGCCGCTCAGACAAGCAGTTCGAAGCGATCGTCCCGCCTGAGCTCAAACCCAAGAGCAGAGCCGAACAAGAGGCGAACCCAATTATC
CCAGCACCGGAGTACAACCACGACACGCTTGCTGAGGTGCTTCGCGCTCTGGAAGCCGTGCAAGACGAGGAGACTGAGGAAGCATAGGCAACGAGCGTTC
ATGATTGTTTCTAATTCACCACTCGTTTTGATACTTCTCGTCTCCTTCCTCATTGATCTCAGGTCCTCGGCGCGCGGTCACCTCGCGCTCATCCACTGTT
CTCCACGATAAACTCCAAGTCATTCTCCACATCACGTAGGGTAGTCGTAAATTCACATAATACAAAGGGTTCACACATAGAACGTCGCAGCGACATACAC
AGGTTCACAGCTGAGGTGCCTCTACTGAGCATCGGGCTCAGGAGGCTCATCCCCAGCTTGCATTGCTTGGAATCGTGCTTTCGCCTTGGCGCTCTTGTTG
AACTCGTACAGCAAAGCTCCATAACTTAGCTGAGACATGGGAAGCCACTCAGTGTCAGGGTACCCCTTCCACTTGACCAAGTACTCCCGGACTCTCCGTG
AAGTCCGGGTCCGCTTAACCCAGCGCACATCCTGAATGACCTCCACTTCGTACACATTCTGAGCTTCATCGGGTTCTTCAGCATCTTCATACAACAGAGC
TGCGTCCAGATCATCATCCTCAGCAACTTCAACCTCAACTGTAGGTCGTTCAGGGAACAGGGCACGCGGCTTGAGTCGACTTATGTGGACGCAAGGATAC
AACTTGTACCCAGTCCCTTCGATCTTCAGCTTGCATCGGAAGTCATCTGAGGTCTCCAGAATCCGGAACAGACCGTGCCAGAGGTGAGCGAACTTCTTCG
TGAACCCAGGTTGCACTCGAGCTAGGTATAGCCACACAGCATCACCAACTTTGAAACCCTTCTTGAGTCTCTCAGACAGCTCAGCCCAGATTTTTGTCTA
AGCAGCTGAGCGTTTTACCTTGGGCTCAGCTTGAAAATCCTTAGCCCAGGCCTAAGCGTACTCGTA