Description :
From Genome Similarity Track
Location :
Scaffold_2:1088653- 1090912
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G000791candidate b-glycosidase

Sequence
2259 bases(100 bases per row)
GACGATACGCGAAAAGGTAGCGCAGATGACGCAATTGGATATCTACTCGATGGTGAATGGAGACGTCCGCGATCCCGCGCGCGCACTGAACAAAGATGTC
GTGACCAAGTACGCCAAGGCCGGTATCGGTTCAATCCTGAACGCTCCGTTCAATGGCCGCATCACTGATGGGCGTACGGGGTGGAGCGCAGCCGAGTGGA
AACAAATTATTGACCAGATCCAAGGGATCTACAAGCAATACAACCAAATTCCGATGATTTACGGTATCGACACTATCCACGGCGCAACATACGTGCGTGG
TGCGACGCTGTTTGGCCAGCCGATCAGTGCAGCATCGTCGTTCAACCTGGACTTGGTGTTCCAAATGGGCGAAATCGAAGCCAAAGATACGCTCGCGGCG
GGCATCCCGTGGGTGTTTAGTCCCGTGTTGGGAATCGCAGTGCAGCCGCGATGGGCGCGTGTGTTCGAGACGTTTGGCGAAGATCCGTACGTGTCGTCCC
GCATGGGTGCATCAATCATTCGCGGTATTCAGAGTACAGGTCAGGTCGCAGCGTGCATGAAGCATTTTATTGGGTATTCGAATCCAACGTCTGGCCTTGA
TCGCGCCGACAACGTGATTTCGGACTGGGACCTCGTAAACCATTTCGCACCATCGTTCTTGGCCGCGATTTTGGAGGGCGGCGTGAAAACCGCCATGGAA
TCGTACATCTCGATCAACGGCGAGCCCGTGATCGCGAGTCATCGACTGCTCACGACGTTGCTGCGCTACGACATGAACTTTACGGGTATGCTCGTATCAG
ATTATTCGGAAATCGATCGCATGCACTCGGAGCATCACTTAGTACCGAGCGTTGCTGATGCCGTGCGCGTATCGCTCACAGAAACGTCTCTAGATATGAA
CATGGGACCCAACATGGACGATTTCCTTAACATTGTCGAGAGCCTTGTGGTAAGTGGCACGCTCCCAGAAAGTCGACTCGATGAATCAGTTTTGCGAATT
CTCCAATTGAAAAAAGATCTCGGACTCCTCAGTCAACAAAACGAGAAGGATAACAACGTTGCATCACCATCAAGCGCCTCTGCCATGGATGTCGGCAGCG
CTGACGACCAACGCGTCGCTCTGGCGTTGGCACGGGAATCAGTGATCTTGCTTGAAAACCGGAACCAAACACTCCCGATTCAGCTTTCAGCAGGAGACGA
GAACAAGAATATGAATATTTTCATCACTGGCCCGATCTCCAACAACAAAGGGTACATGTGTGGCGGCTGGTCGGTCTTTTGGCAGGGTTCGTCGAATTCA
TCGCATTTTCCGAATGGCATGACATTTAAAGACGCCATGATCAAGCGCGCGGCTGCAACAACAGCACGAAACATTCACATCGAGCACCTCGATGTCGTTG
ATGTTGATGGCAACATGTCTGGAGAGGATTATGGAAAAGCTGTCGACATCGCCTCACGAAGCGAGTACACGATCGTGGTGCTCGGTGAGGGCAACTACGC
TGAGAAAACGGGGGACATTGCAGATCTTTCGCTGCCCGAGGGTCAACGGAAGTACCTACACTCCTTAACCCAGCTCCCATACACTAAAGTGATCGTTGTG
TTGATCACAGGCCGGCCGCGGTTGCTATACGGGTCGCATGACGACGCGGGTGCCGTGCTGTTGAGTATGCTACCATGTGAACAAGGCGGCGAAGCACTCG
CGGATATTGTGTTTGGGGATGTGAACCCATCGGCAAAGCTCCCGATCACGTACCCGATCGCTGAGGGCAAGCTCTTGCCGTACTTCCACTATGTCAACAC
GAAGTGCCAACCATGGGATGAATGTCCCGTGCAATGGGAGTTTGGCTATGGGCTGAGTTACACCCAGTTTCACTATTCGGACCTGAAATTGAATGCGACG
ACCGTGAATGGTGCCGATGGAGCATTACAAGTCGATGTCACGATCAAGAACACGGGTATTGTGGACGGCAGCGAGGTCGTGCTTCTTTTTGTGTCCCAAA
AGTACCGTTTTGCGCACGTGCCGGAAACGAAATTGCTCAAGAAGTTTCAAAAAGTGCACTTGAAAGCTCAGACAGCAACACAAGTCTCGTTTGTGCTGAA
TGTGAACGACTGGGGCTTTTATGACCCTGAGATTGGAACCGGGTTTCAACGTCGATTTGAAGCTGGTGAGTTTGAAGTCTCGATTCTGCAGAGTCTCAAC
GAAGATCAGAAGCTAGCAGCAACAGTGGCAGCGTTGAATACAGCAGAAAGCAGTGATGA