Description :
From Genome Similarity Track
Location :
contig_34:10886- 14893
Transcript NameFunction/comments
g7733.t1hypothetical protein

Sequence
4007 bases(100 bases per row)
GCAACCGTCTTGCACCCGTATCCACCTCTAATCAGCAGCTTTTGCTACTGATTGTCCTCCGCCACCTCGTGTGATTGCATCACCCCGAAACGACTGCGGC
TAGTGCGATTCCGCTCAAACTCATACAGCAGCGCCCCGCAGTTGAGATCAGCTTCGTCCACCCACGATGGGTCGGCATAGCCCTTCCAGTAGATTTGGTA
TTCTCGATGGACCCGCCCGTATCTGGTTTTGCGCCCGGATCGGACGTCCACGATCTTCTCGACTTCGAATTCGTTATCACCCAAATCATTCTCCCAGCTA
TCTTCTGGTAGAAGTGCTTCATCGAAATCAAAACGATTTTCTTCATGGGTGGTTAGCGTCGCGTTTGGTCGATCAGGAAAACTCTTCACCTTCTTCAACT
TGGAGACGTGCACGATCGGAAACAGGCGATACTCCGTGTGAGCTACTTCGAGCCGAGCAGCATAGCGACCGACCATCTCAATCACCCTGAATGGTCCATG
CCACATATGCGCAAGCTTCCGGGCGTAGCCCTCCTTAACTCGGTCGAGGTACAACCACACTCGCGTCCCAGCTTCAATCTCGTGGGGTCTCACGCCTTCG
TTGTGTTGATCGGCTCTAGCTTGTATCGCGGCCTTGACACGTTCGTTCACTTCCTTACGCGCTCGCTGGTATTGCTGTTGAATGTGATACCGCCACCTTC
GCGGCTCGTGGTCACACCTCCGCGTACTGCCGAGCGGCAACGACGCCTCCAACGTTGATCGTGGGTCCCACCCATGTACGAAATAGAATGGCGTGTCACC
GCGCACCCGATCGTGAGCGGTGTTGATCGCGAAGGTCAGCCTCTCGGCGTACTCATCCCAATCCTGCTGATTCGTATCTGCGACGTACATTTTCAAGGCG
CGAGTGAGTGTCTGCACCATCCTCTCTGCCGTGCCATTAGCTTGTGGGCGGTACGCCATAGTAGCGCGCTGTCTCTGTCCCATTATCCGGTTGAATGCGC
GGAAGAAATCAGACATAAACCCGGGTTCCCGATCATGGCGGATTGCCTCGCTGGCTCCAAAACGACGGAAGACACATTCTTCGTAGTTCTCTGCGATGGT
CTGTGCGGTCCGCGAAGCACTAGCCTTGGCGATCACATATCCCGAGAACAGATCTACCCACACCAACAGCTCCGTATTGCCCTTGAAAGACTTCGGCAGA
GACGGTATATGGTCCATCGCAATAATCTGGAATGGGTACGTAGCCTGTACGTTACCTGGCGACTCACCCTGTACCACTGGGCGCCCTTTCCCAGTCTCAC
AATCCAAACATTCCCCCACGAATCTCTGGACACTCTTGAATAGGCCTCGCCAGTGGAAGTGGGCCTTGATCCGCTGGTACGTACGGCCGATCCCCTGGTG
TCCGCCCTCCAAACTGGCATGATAATGATGGAGGAAATCTTGATGCAGGGTCGCGGGGACTACCAAACGCGCCATCGAGTCGCGGTTTTCGTCGGTCCGC
GTCATGTTCCCGCAATAGAACAACAGATCGCCTTCGCCTACGTCGTAGTCTCCGGCGATCTTCGCGCACAGCCTCGCATCTTTGGAGCTAAGATCGGCAA
CGTCTCCTCTCAGGTAAGCCTTTAGGTCCCCGATCCACTTTTCCTCGTTCTGTGCTCTGGCGATCCGCTCACTTCTCATGCGGTGTACGATCGTCTCTTG
CAGCGAAGCCGATACTTGGCGTGTCCTCCTCGCTGATCGCGTCACGGCGGTCACCTGGACAATAGAGTCATCGTTTGCCGTTTTCAGTACTTCACCTAAT
CGGTTGATCGCGATCAGATCGTCGATCTCCCCTTCGGCCGACACAATCGCTCCTGCTTCTCGCTGTAAGGCAGTGCTTGCTAGCCGATCAGCGCTTTGGT
TCCAGTCGCGTTTCACGTGGAGTAGGTCGTGCGTCGGCCAGGCCTTCAGTCGTCCCATCGCCTTCTCGCGCAGCACCTGGAGTCCCGGCGCCTTACAGTC
GATCTCCCCTCTCATTTGTCGGATGATCAGGTTGGAGTCTCCACAGATGATCACCCGCCCCTTGTCTTGGTCAGACAGGAGTTTGAAACCCAGTAGCAGA
CCGCGGTATTCGGCTTCATTCACCGTTAGATCAACGGTGAACTCTGACGCAGCGGCTACTATGGACCATTCGGGTAACTGCCACACGATCGCGCTGTATG
CTCCCGCGCTCCTCTTGACACGTGCCGAGCCGTCGAAGCTTACGACCAGCAGTCTCTCGTCTAGACCCACTGTGGGTGGAAGCTTCGCGATTGTCTGCTT
CGGTTCCTTAACTGGGGCTATGGCGATCAAGGCATCGTCCACCTTTGACCGCGGAGTGATACTGGCGGCGATCGCCCCCAGTATTTCGTCTTCTCCTTTG
GTGCACTTCCTGATCTCCATCGTCCATTCCGACAGTAGAGCGGCCCAACGTCCTAGACGTCCTTGGAAACCCGTTGATTTCAAAAGCCAAGCGAGTGTCG
AGTATCTTGACAGAACTTTGATTGATCGGTTGGTCAGGGTGGTGTAACATACGTCCAGGATTCGAAGAAGTGCGAGCACTTCCTTGTCGACCATACCGTA
ATTCAACTCGTTCGACTTCAACGTACGGCTCGTGAAGATCACTGGCCAGTACGTTCCTTCGTGCTCCTGCACCAGCGCAGCAGAGATCGCCCACTTATTC
GCATATACGACGATCACCGGTTGGCGATCAGAATCGAAGTGCCGTAAGATCGGGGTAGTTACCAGCTTGGACTTCAGCAGATTGAATGCTGTCTTCGCAC
GGACCCAGCGGTCGTTCGCTTTGCCTGTTTGATCGGCATTTCCGATGCAATTTATCTCATGGAAGTCCACTTCACGAAGTTCGTACAAGACCGCCGCATA
CACCGCGAAGTCCTCGATGAACCGACTATAATAGTTCAGGCTCCCGAGGAATGACTGCATCGATCGCAACGTTTTCGGGAATGGCAGCCTCTCCAGTGAC
TCGAGATCTTTCGGCTTGGCCTCCAACCCTTCCGCAGACACTCGGTGACCAAGGTAATCGACCTTGCGATATCCCCAGAAACTTTTAACCACGCTGATCG
ACAAGTTCCACCGATCACAGGCGTCAAGCAGTTTTTCTACTTTCTCGCAAACGTCGTCCCAAGAGCCGGCAGAGATCAGGATATCATCGATGTATGATCG
ACGCCCCAGCACTGAAGGTCTCGGTTCATCCTCGGGTTCGCCTTCCTTGAACACGTCGACCAGCTTGGATGGATCAGCGTTTGGACTGATTCGGAAATGT
CCATACAGCGCGTTGTCTATCAGTCGTTGGTAGATCTGTGGGGCATTCTTCAGGCCGAACGGCATACGCGTCCATTCGAAGAGGCCGAACGGCGTGACAA
AGGCTGAGATCTTCCGAGCGCGTTCTGTCATTGAGACTACCCAGAAGCCACTTGCCATATCCAATGAACAGTACCAGAGCGCTTTGTCCAGATCCTCCAA
AAGATCGTTGACCAAAGGCATGGGGTACACCATCAGGCGGGTGAGACTGTTGACCAAACGGTAGTCAATGCACAGCCGAATGTCGACACCGTTTTTCTTG
ATGATGATCACGATTGGTGATGCCCACGGCGATGTCGAAGGTTCGATCATCTTTGCCGACAACAGACTTTTGATCAGCTCGGACAACTTCTCTCGGAACT
GCGGAGCTACACGTCTGACGCGTTGGGCCACAGGCGTTGCTCCTCCAACATCGATATCACATACCGCTCCGTTCGCGGCTGGCGGCAGGGCATTTCCTTT
GCCGATCAGCAAGTGACGGCGACGCCAGATGATTTGCCGCAGGCGATCAATCTCTGGGGTATTCGCTTCCGAATCACCCACTTGGATGTCTTCGATCGAG
ACCTCGTCGGTTGAGCTGGACACCTCGGGAAGGATTGCCATGTGACCCTCTACGTCTTCAGCAAACAGATCGCCACCTTCGTGTAGGCATACCTCTTCGT
CCTCCGC