Description :
From Genome Similarity Track
Location :
scaffold_224:10883- 19819
Transcript NameFunction/comments
g5911.t1 U3 small nucleolar RNA-associated protein, putative

Sequence
8936 bases(100 bases per row)
TCTACTCGGCACCTGGACGCTGCACCTTCGTGGGACGCACTGCTGCAGATGTTGAGCCCTTGAGAACAGCGTGCTTGCGCTTGCGCATCTGCTTGGTACG
ACGCTTCTCCTCGTTCTTCTGCATTCGGCGCTGTGCAGCACGCTGTGGATCAGACACAGCCTCGGTGCGACGTTGCAACTTGCGGGCGGCACGACGTGCA
GCCATCTTCCTCTGTACGAATGAGTACGCCTCCAAGAACGGTGTTGCTCCCAGCTTCTGCTCAAGAAGCTGTAGCACCTCCTGTGCCAGCAGAGCGCTCT
CGGGTGGTGTAACGGGCTCCGGAGCGGGGCCACTTCTCCGGTTCTTGTTACGGTTCTGCTGCCTTTGTAGCATCGCTTGCTCTTGTTGAGCCTGAAGTTC
TTCCAGCTTGCTAATGGCGCGATACAGTGGGTTGATCATCTGCACAACGTACTTTTCAGCAAATGCAGCGTCGTGATTGTGCAACAGAGCAGCAAACAGC
TTGAAGACCACAGCCTGCACGTCGTTACTGCAGTTCGAGCCACGCGCAACATACGAAAGACGAGTAAGCAGCCAGCCGATGGGTGTACGCGACTTGGTAC
GCTCTTCGTCCTTCTCGTTCTGCTCTTGACGCTGCAGATCCTCTTCATCTCCCTTCTCTCCATCTTCAACTTCCTCATCTTGACCTTCAGCTTCAACCGC
ACCATCAGCATCTGCTTCTTCGACCAAAACCTCGGAAGCAGCAGCTGTCATGTCCTGCGGGATGTCCGTGGTCTCGAGTGCTTCGAGCAAGAACGGCAAC
GCGGTGAGCACTTCATTGGCGAGGTCGTCATTTAGTGCTGGCGCTTCCAGCAGCTTGCAGAACGCGCTAGCCCAAGAGAACAGGCGACCAGGGCGCTGCA
AGTACAGAGCACCATTGCGCAGACGCTCGAGGGCGTCTCCAGCCAGACGCTTCACTGGAACCGCGAAAGTGAGAGTACTAGCCTGACGACGACGCAAATA
CGACGTCAGCAAACGGGCTGCGCCGAGCCGCACCCATCCATGCGGGTACTGCAGTAGTGGCAGCACCAGATTATCCAGGAAGCTTTTGGTCGGCTTCGAT
TCCTCCAGCCACAGCTCGAAGGGGCCAGCCAAATGGGTGCTGAAAGCGGTCAGTGCAACACAGACATGATAAGTCGGCTGCCACCGCACCTGGCTGCTAT
TCTCCACGGTTTGAAGCTCACGCTGACGACGCTCGAGCGCCGTACGAGCCGCAAGCAGCACCTGAGGAGCACTACGCTCAAAGAATTCAGGGCGGGTTTC
CAGTACGAGTGTCGTCACCTGCGCCGCCGTTCCCAACAGCTTCACTGCATCAGCGCCATCCGAGTTCGAAGATTGTGTCCACCACGTGCCAACGAGCAGA
ATGCTTTCGTTCAGCTCCTTGTTGCCAAGACGACGTACCAAAGTACTGAGAGCAACGCGAGCAAGGTCACGGCATTCTGAGGCCTCGTCGTTGGCCAGGC
GCAGTACAAGCGGCAGGAAGAAAAACTGTGAGCGAGTATTCACCATATCCTGGGGGAGCTTCGAGAGAAGCGAACGCAAAGCCTCAAGCACAGCAGACCG
CCCAGTGGCATGTCCGTAGCTTAAGTTGTCAACCAGGAACTTGAGGTGGCGAGATAGACGCTTGTTTCCAAGAGGATACTCGAGCAGGAAGGTCTGGTAG
ATCGTTGCACAATTCAGACGCGCACCAGGGGCATCGCTCTGAACCAACAGCTCGCCGACACGCAGCATCACATCGTACACTTCGCTCACGACAAGACGTG
AGTTCACGATAGCTTTCAATAAAGCGAAAGTAGCATTCTGGTGATCTTGCTCGTCGAGATCAGCACGCAAGAAGCTCAGAAGCACGCGAAGCTGGGGCTC
TGTAAGGCGAAGATTCTCGTTCTTGGAATCCTTTGCAGAATTGCCGTTGTCTTGAGCAAGTTCCAGCCCTTGTTGTTGTCGGAGAAGCGCAGTTAGTGTA
CGATAGCATGTCTGCACCATTTCGTTGCGAGTAGCAGCTCCAGCCTGCTGCAGAATCTTGAAAAGGCGGTCAAGCAGCGGTGTACGGGCCACCCGAAGAG
CAGGAAGTTCTTCCTGACGAGGAAGCAACGATCCTAAGCACTTCAACGCGTTGATCACAGCGCGGTCGTTTTTAGACTCACCAGCACAGCGCATCAGCAG
CGGTACCAAAGGGTCGACAAGTTGAGCAGGAGCATTGGAATTCTTCTTGTCCGCGTTCTCCTGATCCTTAGCATTGCCGTTCATGCGGAGGAAAGAGAAT
ACCAGAAAAACAGCAAAGTTGAGTAACTCTCGGAGGTGAGCCGTGCTTTCAGCAAGGAGAGCCGCAATCGCCTCGCGCTTTTGCTTCTTGGTCTTGCCTT
GCTGTTGTTGGCGCATCTTGTCGAAGCCTGTGACTTGCTGTTGCATCGTAACACGAGCTGTGTCTATCGATCTTACTCGCTTGGCGAGCAACTTTGTAGC
GGTTGCACTCTTCTCCGACACCAACCACGACGTTACCAGTGCCGTGCTGGTGCCACCTGCTTCATACTGCTCCTTTTCCCTCTCGGTAGCCGGACGTAGA
CTTTCGAGGGTCGAGTTTAGCACATTGTAGGCGTACAAGAACATGTAGGACGACTCCACCGATGGGTTCTTTGCAAGTCCAATCGCCACACGTTTGAGTG
CCTCCTGTAGAGCAGCGGTAGCTTGGGCACCAGCGTCAGTCGCCTGGAAACGTTTGACAAGTGCGCTTACAACTTCATGAATGCTTGGATTGGGGAGGAA
AGGGAGCGATCTGGCCAGCAACTCCAGTGAATCCAAACTGCGTCCACCGCTAGCACGCGCTTCCTTCATCTTAGACTTTTGGGCCGTCTTCCGTTCCACG
CCTCCAGCGGCAGCCTCCGCTGCCTCGCCAATGGTTGTCATGCCCTGGAACAGCTCGGCAGCCAAAATTTCCATTAGGCTTGGAATACAAGCATCCAGCG
GAGAGGCAAACTCAGCCTCACGCTCAGCTTCTTGCTCCTTGTTTTTGGTGAGTAGCAAGGATTGGGGCTTGCGAGAAGGCTTCGCATCTCCGTCCACTTG
CATGATATTCGGTAATTTTTCCAGAAGTGCATGTACAGTAAATGACAGCACGTGAACCATGTAACCATCGCGCAACGTGTGACGAAGCTCCGCTACAATC
GGCAGCAAGAAGCTTGCACCGAGCTCCACAGCGATTCGCACGAGTGTAGTGCGGGCCGAAGCACGCACAGCTTCATCCTTACTCTTCAGCAAGTTTGCGA
ACTTTAATAGTAACTTGGGTAGCTCGCGTTGGAACGTCTCAGCACGCAGCCGACGCAGAACCTTTACAACCGCCAAGGCCAAAGGCACACGCACCGATAC
TGCTTCTTGTGAGAGCGAGGTCGACTCTCCATCATCGTCACGTGACTTAGAGCTCTTCTTTGACGCCACTCCTTTAAACAGGTACGAGTACAGCATTGGA
AGCACTTGCGTTTCCATGTTGTCCTGAACCTTAGAGGCTCCTTCTTCCTCATCATCTTCAGCATCATCGTTAGCCTCAGCTGGTTTGGTACCTGCTTGCA
TCTTGCTGCCTGACGACGAGCTTTGCCATTGAGTTGCTGAGCCTGGCGCCTCGAAGTGAAAGTGGTCGATCACAGCGCAAATAGACATAATGATAGCACC
TTCCATCTCAACGTGGCCATCGATCGACTTCAGAAGTCTACGAAGCAGCGAGAGATAGTGCGACCAACCCAGGAGCCCAGCAGCACTTCCAACACAAGCG
GCGGCCTCAGCACGAAGAGACTCCTGGCTCTTGGCATGACTCTCGTAGACAAAGTGCATCACCAGCGGCAAGATAACACCATTCACGGTCGAGTTTGAAA
ACCGCCGCGGCTCATCCATCTCGCTTTCAGCCTCGTCGCTAGACTGCGCAGCCATAGAGTCCATAAGAGCACTTAAACGCTGAAGAGCACGGCGCTTACG
ATGAGCCTGGATGTGCGTAATGTTGTAGAAGAAATCAGCTTCAGGGTCTTCTTGATTCCGCGCCAGTATCAGATCCGCTGGAACAAAGGCAAGCTGCTTA
AACGCCTTGTGCTGGTCTGCCAACGATCCCAACAATGTCACGAAGCCACGTCGCGTGTTCTCGTCGGTTGAACGTAGACTCGCACGAACGCAAGGCATCA
GTAGCGACTCCAGGGCATTAAGCACGGGGGATTTAACGGCATCTTGCTCAACTGCAACCTCTGCGGCAAGTCCCAGGAAAGCCGTAAGTCCTGCAAGAGC
ACCGCTACGCACTGAAAACTCTGCATCATGCATGCAGTGAAGACATTGCGCGACAATGGGTGCTAGCAAGTGCGTCTCATCCGTAAACCCGGCAAAACGC
GTGGAGTTCAAACGATTCAGCGCAATGAGTCGACGTTCATAGTCGGTTTCCTCGATACGCTTCGAATCGTACGCATTGAGTTCAACGAGCAACTCTGCCA
CGGGGCCCAGCTCCTTCAGCGTTGGGTGCACGCCTAGAGCCGTGAACACCGCCACAAGTTTTAGGCGAGGATCACGATCAGCAATGCAGTTCGCACCCGG
GGCTAGCAATCGTGCGAGGGCAAGCACATGCTTCTTAGGATCCGACAGCTTGGGGACCATGTGCGCTAGTACCTCCAGCAAGTTCTCCTTGTCCTTCGTA
GATGTCTGGTGGTTGCGCAACAAAAACGGCAACAGCAACTGGAACAAATCATGCGCAGCAACGGCGATGTCTCCCGTTGAGGTTTCCAAGTTATGCGATA
GGCGGCACAGGAATGTAAGTTCCTTCCGTGACGATCCTGCGTACCGATCGTTTGCGTAGCGAGCAGCCTTAGCCTGGAAACGCCGCACAAACTGCTCCAA
CACGAACGGGATCTGAGGAATCAGTAGCGTCTTGCTTGCTTTCTTGGACACAGTCATAGTCTCATCTTGAGCCTGTTGATCGAGGAAGCGCTCGTCCCCG
TCTAGCAACGAGTCCATGAACTGCAGAATAGAGTCCAGGATTTCGGGTGAAATACCACGAGTAGCTGTAGACGTTGCACTTGACGACGTCAGCCCAGCTG
ACAAACACGAGATGACGTTGAGTACCAGAGATTCTGGGACCCACTGGTGTGCTGTTTCGGCGCGCCCCATTGCCACAAGCAACTCCAAAAGCGCCGACGC
CTTGCCTGCACCAACAACCGAATTGGGCAGATGTGTGATTGCATCATGAGATGTTTCCAGCACAGCAGCTACCCAAGGTTGAAGATGTACGAGGGTGTCA
AACATGTCAATCACTTCCGCAAGCCGACGGTAGGTCAGCATACGAATCTGTTTCTTCATGGAGGCCGAGGTCGCCAACTTGTTCACAGTCAACGTGCTCT
CATCGGCCTTCCTCTTCAAACCGACCACCGTGGGCTTATCGTGTTGATCGTCTTCGTCAGCTTCTGCCGAGCCATCCATATCTTCATCCTCTCCAGTAAC
GATGCTAATCTGGAGAATAGCCACCAGCACATCAGCAATGCGAGGAACAAATGTTGCTAGCTTCACACCGAGTTGGCCAATGAGGTCCTCCAGTAGGTTT
AAGAAACCCAAAATACGTGACGGTTGAACGGAAGCCACGGCTGGGACAGGCTTCACCCCGTCAGTCGAACCGAGAGTTTCAGAGTTAGGATTCTTCGGAG
CTTCAATCTTGACATCAAATGCGCGCACCACCAATTCAACGAAACTAGCAAGCTCAGGAGCTTCCAACGCTGCCAGGTATGCCAGGATGGCAGCACGACG
AGCGGCGACGGTATCACCGTTGTTACGACCCTTCTTGCTAACACACTTCGAGTACAGGACTCGCAGAAGGACAGGCAACAGCTCCGGGCGGTGCTCGCGA
AGGATGACCCCTTCACCATTCCCAACCTTAAAGCTCGCAAGTTCTTCCCGGAACGACGATGAGTCCGTCAGACGATTCAGCTGTGTTTTGTAGGAAACGA
CAGCCTTACTACCGAAAGCGTATAGGCACTGCAAAGCCAGCTTCGAGACGACTTCATCCGACTTCATCAACAGGTCGAAGAAGAGTGCATGAAGCAACTG
CTGCGCATACGCACCCTTCATATTGCGGAAGGCGGCGAAAAGCTTCAGTTGATCCACAAATTTGCCGCGCACTTCTTTAGTAGTCAATTCCTGGAACTCA
ACGGGTTTGCGCCAATCGGGTGAATCTGCATCACAACTGCCGAGCTTTGCAAGTGCCTGATCAATTTCGTCAAGGCGATTAGCGTCCAGCTCGTCTGTGT
AAATGGAACTGTACTGGTCACGCAGAAACGTCAAGAAGAGCGGGACCATGAACTTCGTCTTGGCTTCAACTAGGTCAGCGAACTTCATGAGCCCCTTCCA
AAGCAGTGAATGATGACTAGCAGCATCTGTAGCGCTTGAAGCAGGCACCCTGCCCTGTTCCAGCATGCACACTCGTTTAAACTCCTCGACAACAACGCTC
GCGCTGTTCGACTCGCTATCGTTCTTCCTGTTAGCGTTTTCATAGCGAAGGGAAGCCACCAGAATCTCCGAGCTAATGCACGGCCAAAACTCGTTGAAGT
GCAACCGAACAGCAGTCTCCACTGCGTCGGCAACGTGCGGCCAGATCGTGGAGAACTTTACGTGGTACAGACCCAATAGCTGGTTCACAGCAATTTTCTT
GTATATCTCGGGAGTCTGAGATGAACCACAGAGGATTTTCACTCGTGTCAGCAGGCGCACCACTTCACGCTCAGTGGCCACAGAAATATTCTTGCACGAT
AACTCAAGGTTCACGCAAATATCAGGCAAATCACACGGACCGCTCAGCGAGCCACTTTCAGATTCATGGAAATCTGAGCGCTTGAACCGAGCCAATAACT
GCAGTGCCACTAAACGCAGCTCATGTGCAGGTGATCGCAGCGTCGCAAAAAGAGCGCTTGCTACGCGAGGCAATACATCCACAGTCAGTACTGCATGGCA
CTGGGCCTCGGTGCCCATTTCAATCAACAGCAACAGCGTTGACAGGGTACTGAGTGAAATCTCCTTGCCAACCAGTGCCTGCTCCACGTACTTAATCGTC
ATCAGCGAGCCTTCGCTCTTAATCTGATGCTTGGCAATCTCCTGCAGCTGCCACAACTGAGCACGTAATGTGGTTACTTCGACAGGCGACGCGGAAGATA
AAGCGTTCCATTGCTTGCCATACTTCGCAAACAGAGATGTTGTGAAAGCAACTAGCTTTGCATTGTCCAACTGCAAAAGTTGCAACGCCTTGCAAAACTT
CCACTTGACGGCCAAATCCTCGCTGTCCTTGAAAAGCTTTCGGCCGTGGTCAAACAGCACCTTCTGATAATTTGGGGCAACTTCGTCAAATGAAAGCAGC
CAGAAGCGGCTGTTGTTCTTCGAGCGAACAATGTATGAACTTTGATCCTCATTGATTTCGCCAGCATTGTCTGCAACGTAACCACCAAGCTGACACAGCA
GAGAGCTAAAAGCGCTCACATCTGCCTTCAGGAGAGTCTTAAGCGCGAACTCCAGAGCGTTCGGAATCAAAAATTCGACCACAAAGCCTACGTCGACATG
CGCATTGTTCAGCTCCTGGTTCACAAACTCCACCAGCTTCTGGCGCCAATACACCTGCATATCCTCAGTCTCAGCCACAGCAAAAATCGCCTTTACTTGT
GTAGATATGACATCGTCTTCAGCTGGAAACAGTCTCCAGACAGCTTCAAACGTTTGCATCAGCACATCACGCAGGATCGTGCTTTCAGAGGTCAGCACCT
TATTTTCAGGCGCAACTAGCGCAGTGCAAACCGTGTGCACGCTGGGTACTCGCGTTCCATACGCATCCTTTGCACCCGAAATCAGATTGCCCATTCTTGA
AATCAAAAATCCTAGCAGAACACGCAGCACACGACTCAAATACAGGTCGTCTGCTTCGGTAGGCACCTCATCCTTCTCATGACGAATATTCGTCACCTTG
TTTACCACCAAAACCAAACAATCCAGCATCTCCCCGGAGTGGTCAGCATCGGTGTGCTTCATCATAAGTCCACAGGTCTTAAAGACGGTCTCAAACACGG
CTTCCTGTTGTTCGCGCAGCTCCTGGGTTTCCTTCTCTTCGTCTTTCGGGCGGAACGAACCGAGCAAAAACAACAGTACCTCGCGCATCCTAGAGTGGAA
CCCGTGATTCACATTCTTGATCAGTGAGAAAAACAACTTGGCCGATCCGTCTCTCAAAATCTCGTTATCGCGTCCCGATCCCCTCACCAGAGCTGTCAGG
TATGCGCGGAGGTATTTCCTCATGGCTTTAGGCGACTCCAGTCTTCGTAGCAGGACCGCAAGTGTCTGGGCTGCAAAGTTCCGAACAAACTCCCTGGGAT
GCCCAAGTAATGGGAAGTAGCACTTGTGCACAGCGTCCATGTCGGCCAAGAGCTGCACCCTCAAGTAGCTAAAGAGCATCGTAAGTGTCTTAAACACTTG
AGTGCTGAGTTCCGGGTCCTTTGTATCAATAACAGCCACCACGAGAGGCAAAGTAGAGGCGAAATGAGGATAAAACTCTTTGCCGAGCTCTCGAGCTAGC
GCCGTGACGAGCTTAAGTACGGGCACGAGTCTCTGGCGCTGCGAGACAGGGTCTGACGCGTCACCTCGTGCATCCTGCAGCTCCTTCTGCAGCCTCTTGG
TCACCTTCTTCAGGTTGTGAATCAGGTGCGGCGTTGTTGTTACTAGCGGCTGCAGTGCGCGGAACAGGAGCTGGAAGCTGTCCAGCGTCGTCAACTCCGC
CTGACACCCGAGTTCCTCCTTGAACGAGAGCTGCGACGCCTCGTCCACTGCGCCTGTTGTCTTGGTGTGCAGTGTGAGCTCATCCTGCAGGTTTTTCACG
CGCTCTTCGACCTTCTGGAAGCGGTGGCGCCGCTTC