Description :
From Genome Similarity Track
Location :
contig_27:108821- 110137
Transcript NameFunction/comments
g6950.t1hypothetical protein
g6951.t1hypothetical protein

Sequence
1316 bases(100 bases per row)
TTTCAACACTCCTCCACGCCGGCAGCGGCGACCTCCCTCTCGTCTCAATGGAGACCTACGATGTCCCGCAGGTTAGCCAGTCTCGGTGCCTCCAAGGCCT
TGGTGAGGACGTCTGCTGGCATCTTCTCGCTCTAGGTACTCGGCCTTGAGCACCCCGCGCTTCGCAAGCGCGCCCACGAACTTGATGCGCACATCAATGT
GCTTCGCCTTGCTCGATGAGCTTTCACCGTCGAGCTGCTTGAGCGCCGCTTGATTGTCGACACGCAGCGACATCGGGCTGGCATGCGTGATGCCCAGCTC
TCCAAGCTACTCGCGCACGCCCAGCAACTCTGTATCCATAACCGAGGCCGCAGTGTACTCAGCCTCCATGGTGGAGAGGCTGACGCCGGTCTGCTTCTTG
CAGATCCACGACACGGGCATCCCGTCAACCGTGAGAAGGCCGCCGGTCACGGACTTCCTGTCCGTCTTGTCGGCAGCGAAGTCCGCGTCGCTGTACGCGA
TGACCTCCAAAGCCCCATGGCCCTTCATGCTTATCCGCAGACTCTTGGTCCCTGCCAAGTAGCGCGCGATGCGCTTGCCGAGCTTCCGTCGGACATCGTG
GGGCTGTGGGTGCGTCGGGACGCTTTGTGCACCGCGTACGCGATGTCAGGGCCCGTGCAACGCGCCCTGACACATAAGGCTCCCCACGAGCGACTGGAAC
TTGCGTACTGTCACCACGCCATCTCCTCCAGTTGTGGGCAGAAGCTCAACTGACGCCTCGTCGATCTCGTTCCACTCGGCGCCGATCGGGGTGCGCACGC
TGTGCACTGACCCCATCCCATGCTCGCGCAGCATCTCCTCGATGGCCAGCTCCTGATCTAAGTCGTAGCCCTCGTCCTCGGCGTATGACACCCTCATGCC
GAAGAAACTTGCTGGCGGGGCCGAGGTCCTTGATGGAGAGCTCGGTCAGCTCGCCGAAGAACGCGTCGACGGCTTGCTGCTGCATTCCCGTGACCAGCAG
GTCGTCGACATACACGCCGACAGCCACCAGGACGCCTTCCCGGCGCCTGTGGTACACGCACATGTCCGTCAGACTCTGGGCGAAGCACAACTTGATGAGA
GCCTTGGTTCCAGAGGCGGGCTGCCTGCTTGAGGCCGTACAAAGCCTTCAGCAACTCCAGCACCAACTCGCAGTCGTTGGTCACGCCCAGTTGCTTACGC
ACGTCTTCTGGAATCACCATTCCGCGCGGCAGGCGCAGGAAGATGTCCAGCTCCGCCTCCTTGTCGGCCTTGACGTACGCGTTGGGCACGTCGCCGTGCT
TCGCGGGGACTCGCCA