Description :
From Genome Similarity Track
Location :
contig_34:10882- 14888
Transcript NameFunction/comments
g8109.t1hypothetical protein

Sequence
4006 bases(100 bases per row)
GCAACCGTCTTGCACCCGTATCCACCTCTAATCAGCAGCTTTTGCTACTGATTGTCCTCCGCCACCTCGTGTGATTGCATCACCCCGAAACGACTGCGGC
TAGTGCGATTCCGCTCAAACTCATACAGCAGCGCCCCACAGTTGAGATCAGCTTCGTCCACCCACGATGGGTCGGCATAGCCCTTCCAGTAGATTTGGTA
TTCTCGATGGACCCGCCCGTATCTGGTTTTGCGCCCGGATCGGACGTCCACGATCTTCTCGACTTCGAATTCGTTATCACCCAAATCATTCTCCCAGCTA
TCTTCTGGTAGAAGTGCTTCATCGAAATCAAAACGATTTTCTTCATGGGTGGTTAGCGTCGCGTTTGGTCGATCAGGAAAACTCTTCACCTTCTTCAACT
TGGAGACGTGCACGATCGGAAACAGGCGATACTCCGTGTGAGCTACTTCGAGCCGAGCAGCATAGCGACCGACCATCTCAATCACCCTGAATGGTCCATG
CCACATATGCGCAAGCTTCCGGGCGTAGCCCTCCTTAACTCGGTCGAGGTACAACCACACTCGCGTCCCAGCTTCAATCTCGTGGGGTCTCACGCCTTCG
TTGTGTTGATCGGCTCTAGCTTGTATCGCGGCCTTGACACGTTCGTTCACTTCCTTACGCGCTCGCTGGTATTGCTGTTGAATGTGATACCGCCACCTTC
GCGGCTCGTGGTCACACCTCCGCGTACTGCCGAGCGGCAACGACGCCTCCAACGTTGATCGTGGGTCCCACCCATGTACGAAATAGAATGGCGTGTCACC
GCGCACCCGATCGTGAGCGGTGTTGATCGCGAAGGTCAGCCTCTCGGCGTACTCATCCCAATCCTGCTGATTCGTATCTGCGACGTACATTTTCAAGGCG
CGAGTGAGTGTCTGCACCATCCTCTCTGCCGTGCCATTAGCTTGTGGGCGGTACGCCATAGTAGCGCGCTGTCTCTGTCCCATTATCCGGTTGAATGCGC
GGAAGAAATCAGACATAAACCCGGGTTCCCGATCATGGCGGATTGCCTCGCTGGCTCCAAAACGACGGAAGACACATTCTTCGTAGTTCTCTGCGATGGT
CTGTGCGGTCCGCGAAGCACTAGCCTTGGCGATCACATATCCCGAGAACAGATCTACCCACACCAACAGCTCCGTATTGCCCTTGAAAGACTTCGGCAGA
GACGGTATATGGTCCATCGCAATAATCTGGAATGGGTACGTAGCCTGTACGTTACCTGGCGACTCACCCTGTACCACTGGGCGCCCTTTCCCAGTCTCAC
AATCCAAACATTCCCCCACGAATCTCTGGACACTCTTGAATAGGCCTCGCCAGTGGAAGTGGGCCTTGATTCGCTGGTACGTACGGCCGATCCCCTGGTG
TCCGCCCTCCAAACTGGCATGATAATGATGGAGGAAATCTTGATGCAGGGTCGCGGGGACTACCAAACGCGCCATCGAGTCGCGGTTTTCGTCGGTCCGC
GTTATGTTCCCGCAATAGAACAACAGATCGCCTTCGCCTACGTCGTAGTCTCCGGCGATCTTCGCGCACAGCCTCGCATCTTTGGAGCTAAGATCGGCAA
CGTCTCCTCTCAGGTAAGCCTTCAGGTCCCCGATCCACTTTTCCTCGTTCTGTGCTCTGGCGATCCGCTCACTTCTCATGCGTTGTACGATCGTCTCTTG
CAGCGAAGCCGATACTTGGCGTGTCCTCCTCGCTGATCGCGTCACGGCGGTCACCTGGACAATAGAGTCATCGTTTGCCGTTTTCAGCACTTCACCTAAT
CGGTTGATCGCGATCAGATCGTCGATCTCCCCTTCGGCCGACACAATCGCCCCTGCTTCTCGCTGTAAGGCAGTGCTTGCTAGCCGATCAGCGCTTTGGT
TCCAGTCGCGTTTCACGTGGAGTAGGTCGTGCGTCGGCCAGGCCTTCAGTTGTCCCATCGCCTTCTCGCGCAGCACCTGGAGTCCCGGCGCCTTACAGTC
GATCTCCCCTCTCATTTGTCGGATGATCAGGTTGGAGTCTCCACAGATGATCACCCGCCCCTTGTCTTGGTCAGACAGGAGTTTGAAACCCAGTAGCAGA
CCGCGGTATTCGGCTTCATTCACCGTTAGATCAACGGTGAACTCTGACGCAGCGGCTACTATGGACCATTCGGGTAACTGCCACACGATCGCGCTGTATG
CTCCCGCGCTCCTCTTGACACGTGCCGAGCCGTCGAAGCTTACGACCAGCAGTCTCTCGTCTAGACCCACTGTGGGTGGAAGCTTCGCGATTGTCTGCTT
CGGTTCCTTAACTGGGGCTATGGCGATCAAGGCATCGTCCACCTTTGACCGCGGAGTGATACTGGCGGCGATCGCCCCCAGTATTTCGTCTTCTCCTTTG
GTGCACTTCCTGATCTCCATCGTCCATTCCGACAGTAGAGCGGCCCAACGTCCTAGACGTCCTTGGAAACCCGTTGATTTCAAAAGCCAAGCGAGTGTCG
AGTATCTTGACAGAACTTTGATTGATCGGTTGGTCAGGGTGGTGTAACATACGTCCAGGATTCGAAGAAGTGCGAGCACTTCCTTGTCGACCATACCGTA
ATTCAACTCGTTCGACTTCAACGTACGGCTCGTGAAGATCACTGGCCAGTACGTTCCTTCGTGCTCCTGCACCAGCGCAGCAGAGATCGCCCACTTATTC
GCATATACGACGATCACCGGTTGGCGATCAGAATCGAAGTGCCGTAAGATCGGGGTAGTTACCAGCTTGGACTTCAGCAGATTGAATGCTGTCTTCGCAC
GGACCCAGCGGTCGTTCGCTTTGCCTGTTTGATCGGCATTTCCGATGCAATTTATCTCATGGAAGTCCACTTCACGAAGTTCGTACAAGACCGCCGCATA
CACCGCGAAGTCCTCGATGAACCGACTATAATAGTTCAGGCTCCCGAGGAATGACTGCATCGATCGCAACGTTTTCGGGAATGGCAGCCTCTCCAGTGAC
TCGAGATCTTTCGGCTTGGCCTCCAACCCTTCCGCAGACACTCGGTGACCAAGGTAATCGACCTTGCGATATCCCCAGAAACTTTTAACCACGCTGATCG
ACAAGTTCCACCGATCACAGGCGTCAAGCAGTTTTTCTACTTTCTCGCAAACGTCGTCCCAAGAGCCGGCAGAGATCAGGATATCATCGATGTATGATCG
ACGCCCCAGCACTGAAGGTCTCGGTTCATCCTCGGGTTCGCCTTCCTTGAACACGTCGACCAGCTTGGATGGATCAGCGTTTGGACTGATTCGGAAATGT
CCATACAGCGCGTTGTCTATCAGTCGTTGGTAGATCTGTGGGGCATTCTTCAGGCCGAACGGCATACGCGTCCATTCGAAGAGGCCGAACGGCGTGACAA
AGGCTGAGATCTTCCGAGCGCGTTCTGTCATTGAGACTACCCAGAAGCCACTTGCCATATCCAATGAACAGTACCAGAGCGCTTTGTCCAGATCCTCCAA
AAGATCGTTGACCAAAGGCATGGGGTACACCATCAGGCGGGTGAGACTGTTGACCAAACGGTAGTCAATGCACAGCCGAATGTCGACACCGTTTTCTTGA
TGATGATCACGATTGGTGATGCCCACGGCGATGTCGAAGGTTCGATCATCTTTGCCGACAACAGACTTTTGATCAGCTCGGACAACTTCTCTCGGAACTG
CGGAGCTACACGTCTGACGCGTTGGGCCACAGGCGTTGCTCCTCCAACATCGATATCACATACCGCTCCGTTCGCGGCTGGCGGCAGGGCATTTCCTTTG
CCGATCAGCAAGTGACGGCGACGCCAGATGATTTGCCGCAGGCGATCAATCTCTGGGGTATTCGCTTCCGAATCACCCACTTGGATGTCTTCGATCGAGA
CCTCGTCGGTTGAGCTGGACACCTCGGGAAGGATTGCCATGTGACCCTCTACGTCTTCAGCAAACAGATCGCCACCTTCGTGTAGGCATACCTCTTCGTC
CTCCGC