Description :
From Genome Similarity Track
Location :
contig_27:108807- 110123
Transcript NameFunction/comments
g7288.t1hypothetical protein

Sequence
1316 bases(100 bases per row)
TTTCAACACTCCTCCACGCCGGCAGCGGCGACCTCCCTCTCGTCTCAATGGAGACCTACGATGTCCCACAGGTTATCCAGTCTCGGTGCCTCCAAGGCCT
TGGTGAGGACGTCTGCTGGCATCTTCTCGCTCTAGGTACTCGGCCTTGAGCACCCCGCGCTTCGCAAGCGCGCCCACGAACTTGATGCGCACATCAATGT
GCTTCGCCTTGCTCGATGAGCCTTCACCGTCGAGCTGCTTGAGCGCCGCTTGATTGTCGACACGCAGCGACATCGGGCTGGCATGCGTGATGCCCAGCTC
GCCAAGCTACTCGCGCACGCCCAGCAACTCCGTATCCATAACCGAGGCCGCAGTGTACTCAGCCTCCATGGTGGAGAGGCTGACGCCGGTCTGCTTCTTG
CAGATCCACGACACGGGCATCCCGTCAACCGTGAGAAGGCCGCCGGTCACGGACTTCCTGTCCGTCTTGTCGACAGCGAAGTCCGCGTCGCTGTACGCGA
TGACCTCCAAAGCCCCATGGCCCTTCATGCTTATCCGCAGACTCTTGGTCCCTGCCAAGTAGCGCGCGATGCGCTTGCCGAGCTTCCGTCGGACATCGTG
GGGCTGTGGGTGCGTCGGGACGCTTTGTGGACCGCGTACGCGATGTCAGGGCGCGTTCCACGCGCCCTGACACATAAGGCTCCCCACGAGCGACTGGAAC
TTGCGTACTGTCACCACACCATCTCCTCCAGTTGTGGACAGAAGCTCAACTGACGCCTCGTCGATCTCGTTCCACTCGGCGCCGATCGGGGTGCGCACGC
TGTGCACTAACCCCATCCCGTGCTCGCGCAGCATCTCCTCGATGGCCAGCTCCTGATCTAAGTCGTAGCCCTCGTCCTCGGCGTATGACACCCTCATGCC
GAAGAAACTTGCTGGCGGGGCCGAGGTCCTTGATGGAGAGCTCGGTCAGCTCGCCGAAGAACGCGTCGACGGCTTGCTGCTGCATTCCCGTGACCAGCAG
GTCGTCGACATACACGCCGACAGCCACCAGGATGCCTTCCCGGCGCCTGTGGTACACGCACATGTCCGTCAGACTCTGGGCGAAGCACAACTTGATGAGA
GCCTTGGTTCCAGAGGCGGGCTGCCTGCTTGAGGCCGTACAAAGCCTTCAGCAACTCCAGCACCAACTCGCAGTCGTTGGTCACGCCCAGTTGCTTACGC
ACGTCTTCTGGAATCACCATTCCGCGCGGCAGGCGCAGGAAGATGTCCAGCTCCGCCTGCTTGTCGGCCTTGACGTACGCGTTGGGCACGTCGCCGTGCT
TCGCGGGGACTCGCCA