Description :
From Genome Similarity Track
Location :
scaffold_838:1088- 2623
Transcript NameFunction/comments
g10400.t1hypothetical protein

Sequence
1535 bases(100 bases per row)
AAGTATCTATAATATATTCAGTCTTAAATCTACGTAATCTTAGTTAGTATCCCCAAAGTCTGGGGACGAGTGAACTGCCGTTCATTAGGAGTTTGCATAC
TCCAAGCAAGCTTCCTCTGTGTGAAGTGCTGTGTGACACCCGTCACACTTGGTAGCACATGTAGTCAATCCTACGCCTACGCGGGTAGATTGATTACCTG
AATCCTCTGTGACCAGAAGTTGTTGACCACCATGGATAGAAGTGAGTTTCCTCACTTGACCGACTCTCAGTTTGAGTCTGTCCGGAAGATGCCGGGCATC
TTTGGGATGGATGCCTTCCGAAGCTTGGCGGCGGCGACGCCGGCCGAGCAGGTCAAACGCGTGAATGCGTTCGACATGTACGAACGTGGGCTCATCGAGC
ACGTTCGGGGAATCTTTCGGGCTCCTGTGGCTGAACCGAGGCCGGCTCAGCCCAAGCCTCTAAGACTCAAGGTTCTTCCCTATGAAGGGAAAGAAGGTGA
AAACCTTCACTTCTGGGTCCGAGAAGTTGAGCTCGCCATGGAGGCAGCTCTTATCCCGGCGGAGCGACTTCGAGTCGCTTTCGCGCTGTCTAACCTCGGA
TGTCGAGCGAAGACATGGGCGTATACGCGCGAAGCGACATCGCCAGGATGGTTCAAATCCTGGGCCCATCTGTGCGAACCTCTGTGTGGCAAGGCCACAG
TTCGCCGACGACTACGCCGGACACCGCGCCAGGAAGTGGAGCAGACTCTGGACCCGCCCCTATGGATTTAGGGGTGGCCGAACCGAGAAACATCCGCTGT
TCTGAGTGCGGGCGTTTTGGGCACATCGCACGTGTCTGCCCCTCAGGAGGGCAATGGAAGAAATCTTCCGAGCATCAGGGCTCGAAGGGCCGCTGGAAGA
AGTCGGCGCCCAAGAGTCAGGGGAACGCCGGGCACCAGTAGGGGCGGGGGGCCCTACTGGGGAGAAACTAAGTCCCCATGCGGATTGTACGGGCGGCACA
CACAATGGAGACTTAGCCCCAGAGAGTCTTAGGACTCTCAAAGCAGACAAGGACAGTTGTGGGCTACTAGTTGTACATGCGGATGTACGGGGTATAACAA
CCCCTTTAGAGTCTTGATAGACTCAGGGGCGAGCAAGAACTTTGCTCGCCAACAAACTGTCGCGAGGAATCACGGCAAGTTTGCTGATGCTCTACGAGAG
AGCGAAGGAGACGGGTTAGTCGCCATACGACTAGCCGGTGGTACGGTGATAGAAGTACCGAAGGTCCAAGTGGACCTTGCTGTGATGTTTGAAGACTTCG
ACAGCGTGGAGTCGTTCATTGCCCTTGAGATGGACAAGTACGACTTGATCCTAGCGATACCATAGCTTGAGAAGCACGAACCCTGGATAGGTTGGCGCGG
CAAAGCCATTGGGGCTAGCCTGCCCGCGGTCTCTGACAGAGCCCTGGTGAGTCAAGTTCCCACCTCCGTCAGGACCAAGGGTATTCATAGGAACAGTCAG
GATGCGGCAGCGTCCGAGGAGTTTTTTGGGGCTGG