Description :
From Genome Similarity Track
Location :
Scaffold_602:1088- 2574
Transcript NameFunction/comments
Phyag_g6941hypothetical protein
Phyag_g6942hypothetical protein

Sequence
1486 bases(100 bases per row)
aacaaggtggaggaggggGAAGTtgaggtggtgaagaagctggactCCAGTGTTCAATGTGACGAGGATATGTTCGTCAAAGCTGCAGATGAACCGTTAT
CACGCCGAGATGGTAGCAATAGAGGAGGATGGAGTCGCTTTGAGGAGAGTAAGATGATGGCTATGAAAGACACCAAGCATTCTGATGCCGATGGTCCCAT
GGTCTACTACAAAAGCAGTACTACGAACTCAAGGCATACTGCGCGACAAAGAACTGGGCGAGATTCAAAATCCGCGCGCAATGTACCAGCCACAGTGACT
AAGGGCGATTTATTGTTCCCACGAGAGCTCCCACCGCCGCTTTTCTTTCAGAAGTCCAGACGAGCGAAGCCCTGAAATTTGCGGGTTGTTTCATTTTCTG
CTGAAAATGAAATGGTTATCGAGAAGAATGCGCCATGATGGCCTTGACCTACGAACAACTTTGTGGATCAAAAGTTGACTGAAGTTCGTCGTAGCTGCAC
TTGATGCTGAACGGGTTGAAACTTTGTTGTCGAAAAAGCCGAATGGAAAATACTTTCAGATACTAATCTCCAACGACACGGTGGAAGCATGAACATATgc
gcagctcgagaagtATTGATCAAACCCACGGTGAAGGCGAATGCTGCATTGGTGTGCATTGAATATGCTTACTGAAACTTTCACGCTCTTTAATATATTC
GCTAGTGATAGTTTGCTTGCCCTTCTTCACTGCTCCTTTTGCACGCGCAGCTCGCGGTTGAGATAATAGCCTGACTTGTGCAGGTATGTTGGTGGCAGCT
CGATGGCGTGATTTTGCTCAATCACCTGCAAACAAGAAACAGAAAAAGTTAGAACAAAGTTGTAGCGAATTTCTTCAAGAACTTCGAGGACACATACCCG
GCTGGAAAATATCTCGAAATCTTCCTCAGTCATGGGTCCGTACAAAAGACTCCATTTACCGTCAACAAGCACGAAATAGTAGCGTTCGTTCTCGCCGTGT
TCGTACCAGCCTTCCTCGCCTTGCACGGTGCCTGCGCACGCATTTAGGATACCACTCGaactcttgctgctgtgctgcttcttgtttcCTCCCAGGAATG
ATCGCATCTTCTCGCCGATTTGTCTTCCGAGACCAGCTTTCGTACCATTCTGCTTGCTCGAGGAAGTCCCGGAGCTAGTACGACCTTCGTCGTCCTTCCG
ACTCAAAGACAGATTTGTCGCTCGACCTTCCGATGAACCCTCGCTCCGTATTgtttcctccttcttccCTCGGTCTCGGTCGGGCTCTTCCTTCCTGCTT
GACAGGGATGCAGATCTTGATTCAGACGgcttctcctcggccttgATCTCTAGCTGACTCACTCCTTTTTCCACCTCATGgacagctgcagctaccTTCT
TCTTTTCGGCTTTTCGCGCTGAACGAGAACCTTCTTCAGGTTCAGAATCGTCGTCTTTATCACGCCGCTTCTTGCTACGTCTGGAG