Description :
From Genome Similarity Track
Location :
Scaffold_1629:1088- 2320
Sequence
1232 bases(100 bases per row)
ATTTTGCTGCCGACAAGGGTGACAGAAAGTTAGTCACGGGGGGATAATAACGATCGACGATACGCCATTAAGCCGGATGTGCAAAAAAGCTGGTGGTTCG
ATCTTTACCACGGAAGCTGAGTTCACAGCTGCCTTGAATATGGCTCAAGAATCTATGGGCATACACGAATTGTTCAAGGATTGAATGTGAAGTTCGAGGA
ATCGATTTCATTGCGAGCGGATACCGTACTTAGTGCTCAAAGTACACTGATTGATCTGGAAGAGCGAATTGCTAATAGCTTATCAGTCGTCAATGGTGTT
GAAAACGAAGAGCGAAAGAGACAGCGGCATGGTGATGAATCATCCAAAAGCGTCGACGATGCACCAAAGAATTGTCAAAACAAATCGGTATTAGGACTTT
GTACCTTCTACCACACACAAACGGGTGCTAGACAAGTTGGGCAGACCCATAAGTTCGAGTGATGTCACTTTATTACGGAACAGCAGAGAAGCTGGGCATT
CTGAATATGCATAGCGTGAAGTATGGATGCTATTCAGGATAAGAAAGTACTGGAGGATACCCGGGGCTGATGTCCCGCCAGAAGCCAGACCAGTTAAAAT
CGTGTGGGTATGGGCAATTAAAATTTAATAACATGAACATGTGATTCCTTTTAAAGCACGTTTGGTCTCTCTTGTAAATTGGCAGAGGCCTGGTATAGGC
TTTGAGGAGTGACTTTTCAGTGGTACGTATGTCAAGCTTTAGGGTGACGCCGGCGGCCGAGATCGGTGTGTCGGTGTATGGTGGTGATATGAAAACAGCG
CGACTTAATGCTACTTTGACGATTCCATAGTATGTGAAAGATATTGATGGATTCCTATGTAAGCAAAAGGTTCACAGGTATGTGGTGCGCAAGGCGTTAT
ATGGCCTACGCCAGGCTGGTCGTGAGTGGAATGATGAGTATCACGAATGGATGACTGAGAACATGTATTTAACGTGCTTAACGGAACCGTGTCTATACTA
TCTTCATGACCCGGATGGAACTATATTACTGGTNNNNNNNNNNACGTCGACGATGTATTGACTTTCTGTGTGCAACAAACTATAAATCAGCAAAAGTTGA
CATGTTTGCAAAACTTGCACTGCAGTATGGTATCAAAGGTCGAGAGAAGTTGCGGAGTACCTTAGTATATAAATTTAAGCGAGTCAAGATAGTCTCGGGA
TTATTCGATGAGAATACTCACGTGAGATACTA