Description :
From Genome Similarity Track
Location :
Scaffold_3194:1087- 2123
Transcript NameFunction/comments
Phyta_totarag15133reverse transcriptase

Sequence
1036 bases(100 bases per row)
ACGGATCCGAGGGGTCCTTCAGGATCGCAGCTCATAGCGCCTGTGTCTCTGCGAAGACCGCTCGTCCTCTAACACGTCGGCGTCCATGTGTCGTCTCTGG
GGATATCTCTCTAGGGGAAGGAGGTGGCAAGGCCACCATCTTCGGAGGGGAGAGAAGCCTCCCAGCTGGGCTTCCCGCGCCTACTGAGAGCCATCGTTTT
CCGACATCGCAGACTCAATCACATTGAGAGAGTGGGGGGCGGAAGAGGCCTTGCCTCGAGTCTCGCGCCACGGATTCGTCGGGCACTCACGACGGAAGTG
CCCCAGCTGATTACAGCCGAAGCAGCGACCACTCGCACGCGACTTCCGCGGCGGACGAGTCGATTCAGCCGACGAGATCTCCATGGGAGTAGGCCCTTCA
TTGACCTCCGGTCGACTGGCGTATCCTTGCGCCGAGTGCACGCAGGATGATCTTCCAGCATTGCGATGTGGACCGCCCCGTTAAACATCTGCGCTTGGTG
ACGAAAGAGTTTCGTTCGCACCGGACCCGGGCGAACTCCGTCCATGAAAACTGCCACCTTGACATCCTCAGAGAGGGGAGCTCCGGCCATGGCGGCTTCC
AAGTTCTGGAGCTCCATGATGTAGTCTTGAAGCGTCCGCTTCCCTTGCTTGCAACGCAAGAAGAGTGATCGGTAGCGATAGGCCACATTGGCCAGTAGGA
AGGTGAAGCGAAGCTCTTGTTCCATGAACGCCCATGAGCTGAAGTAGCCCGGNTCAGCTGCGCTCTGCGCTTCGGCTCGCATTGTCGTGCGAGCGGCTTc
ctgcgcagcagcgctgacGTGTGCGATGAGCGACGACTCGTACTTGTCGAAGCGTTCCACGCGCGccctctgctgctgcaggaagagaGTGGAATCCAGT
GAAGGCTGTTTCGCCGAGGAGACTCACCATCTTCTCTAGGGTTGCCCAGTGGGCGTCCGAGAGATGTGGGAAGTCCTGGCGAGACGGCAGCCGATTTGTT
GAGTCTTCCATTCTCAAAGAGAACTTGATTGTTGTA