Description :
From Genome Similarity Track
Location :
Scaffold_3:1086915- 1088431
Transcript NameFunction/comments
Physo_431928Hypothetical protein
Physo_381939Hypothetical protein

Sequence
1516 bases(100 bases per row)
CAAGGCTAAGAAGTTCTGCGAGAAGAGCTGCCCGACGCTCGGCAACTCTTGTGTCAGTGGCATGTGATTACCTAGCTGAAGAAGCAGGCTGCACGTCTGG
CGCCATCGGTGAAGAAGTCGGTGAAGAGCCTGATGCGGTTGATGGTGTACGCAAGCAACGAGGACGAGTATGAAGATGCAAAAGGAGCTGTGTTGGAGTT
GCTTGGAGGCGATACATCACACGAGTTGTACCGCACGTTCATGGCAAACTGGGACAGTAACCAGGACGAGTGGGTTTCCTACAAGCGCGGCAACACGCCG
CACCTGACGAACAACACCAACAATAGGATCGAGTCCAAGTGGGGGAAGATAAAGGATGTTATTAACGACTCCTTCACTATCGACCAACGCCTGTCTACGC
TGATGACGCTGCAGCACTATGCCGAAGAGCAGTATCTCGCAGCATACCATCAAATTAGGAGCCGGCCTTCGCGGGATTCGGAGGACCGCAAGCTGACGCT
GCTGGCTTTGCAGGTGAGCCCGTTTGCCTTCGAATTGGTCGCCAAACAGCACACCTTGGCAACCGGTCCGAACGCAGACTACACGGTTGAGCTGAACACA
CCAGGACGAGCCACTGTCACGAGCCCAAGGTCTGGAGAAGTGCATGAAGTCAACACGAGGGTAAGCTATTCAAGTTATGGTATACTTTTGGTCTATTCAG
TTATCTTTGGTATTGACGACTGACATGTAATCTGTGCTGTACAGGCGAACTCCTGCAACTGTATCTTCATGAAGACCTGCTTGCTACCCTGCCACCACGT
GATGTACGTCCGGAGCACGTCCAACTTCGAAACAGTACTGCCCCCGATGCACTGTTTCCCTACACGATGGATTGTGCAGAGTCCAGAAAACAACATCGAC
TGGGGAGAAATTCCGTGTGGAGGGTTGAAGCAAGGGAGCTGTCCGTCTCGAGCGAAGGAGCGAGCTTTGTCGGGGGCTGCGATGTACATCGAAGCCAAGG
CAACAACGGAGAAGATCATTGCAAGAATGGCACTTCAATCTACACCCACATTTCGGATCGCGCTGAAGTGGCTTCAGGATTTCTACGAAGCGCTCAACTC
CGGCGACGTGGTTGCCTTTGCAGAGCGCGAGGTTCCGGTATTCACGGGGCTTTCTCTAGTGACCTCCAGAGCAAAGGAAACCACCAAAGTTGAAGATACT
GGCGGAATCGAAAGAAGTGAGGAGGAGTCCTGCAGCACTGCTGTTGAAGTCGATGTGGCCGCTGATGGTGAAACTCAAACGGGTGCGGAAGCAGAGGAAG
ATGGCAACGCTACACCCTCCGACCAAACCTTACAAGATTCTACCGAACCCACACAAGTCTCCACCGAATCGAGAAAGCCGTCAGAAGAACGCCCGAAGGC
AGTCACGTGGACGTTTGCGGAGCGTCCAGTGATCAATGGAATGGCCAAGGCTCAGCGAAAGCGTGCCCAAGCTAAACAAGACCGTGAAGCTGCATTGGAA
CTGGCAGCTAAGTACC