Description :
From Genome Similarity Track
Location :
contig_61:108679- 111844
Sequence
3165 bases(100 bases per row)
GTGGCCGCGTGAACACCTCGTATGGCACGATCTCGCTGGGTAGCGATACCGTGTGTGTTGAGACCAATGCGCGAGTAGTCGGCGTTATCTCCACCGGGGG
GACTTCAGTAGGTAGCGATGTGTTGTCTGATATGCCTTCGGGTGATGTAGCTGTGTCATCGGCTGCATCGGTAGCAAGAAGAAGCCGTCAATTAGGCGAC
AATGACTGTGGGGCGCAAGAGAGTGCGTGTGAGGAGCATGGATGATGCCTGACTCTCCAGCTTTCAAGAGGTTCACACGTAACAGGTGAGTGTTGCGATG
TGTGATTGAAAGTAGAAGTATGTGACAAGCTAATCGTGAATATGTTCGTGACATGGGAGCCAACGATGACCATGTTATAGTGAGAGGTGAGGGTGTTGAC
GACCTCTTCCAGCGTAAATCTAGCCTCAACTCAAGCGTAGCGGCAGAAGCAGTAGCTTCCATTTTTGAAGGCATCAGTGCGAGGGATGTTCGCCAGCGTG
CTGGTCGTACCTATGGAAATACTGGGGAAGTGTTACCGTCAGGTGTCTCGAAGATGCTTGAAGCAATTGGGCCTCTTGGAGAGAAGGACATATTTCTCGA
CGTTGGAGCCGGCGTGGGCAATATTCTCGCGCAAGTTGCGCTTATGACGGAAGTGAGAATGTGTATCGGCCTCGAGGTCCGAAGCGATCTGGTCACACTT
GGACAGAGCTGCATACGACAACACCTCAAGAACCACCCCCATCTTGCTAAGGTGGAGGTCAGGCTAGTGGATGCTCGCGATGTTTTGCTATCAAGTCAGC
CTCCATTTTGTGAAGCCACCATTGTCTTTGCTAACATATTTTTATTTGAAGAGCACGCGAAGTTGGTTATTTCGCAAGAACTTAGTGCAATGCCAGCGGC
ACGGGTGATTATCGCAACTTCGAAGTTTTGTCCAAGGCATCGCTCCGCATGCTCAGAGCCCTATTGCAAGTGCTGGAAGTTAGTGCACCAGATAGAAGTT
CGTGTAAGCTGGAAGGCGGCTTGTCATCAAATTTACATCTATCATAAAAAATGTTAAACCCACTTTGCTCTGCTTCTATTGAGATCATCTGCAACGCTGT
CAAGCCTGCATGTTTTATCAGACCACGATAACTATTCCATGTGCGATGACTCCATGGTCTTCAGCTCCAGCTGCATTAAACCCCGAGTGGTCACCAGGTC
ATGAACGAGGGTGCCTACAGCACGCCATTCAGACGCACTTTACGGATGCCCAGCTCCCAATCTCGAGCTGTGTCATTGGCCAGCACCACTGTGTAAAATC
ACTGTATTATCTTCGTCACCTTCACGGACCATGAGTACCACCTCCACCAAGTCTGTGAGAACCGCCACCACCGTCAGTCTCCTCATTGCTGAGGTTGGAA
AAAGTCTCGCCAAGTTCGCACGCAAGCACCATTACCGCCGAGATCCGCCTCGCTGTACCCAAGAGCGGTGTCGCCGTCGAGAACCGTGTCATCACAGTTT
GGGGTCGTGCTGTCGCCACTGTCGCGTGCGTAAGCGGCACCAAGACCTGCCTCGACGCCGAGATGGGGCACAATTCCACTGTCTAGTGCAAACGCAGCAA
GTTCGTGAGCGGAGTTGCTGCCACCCAGACCGAATGCAGCAAGACGTTGAGGTCTGCTGGTGTCGCGACTTAGATCAGCACCACCACCGCGTTCGTGTAT
GACAGAATCACCACCGGATGCGCAAGCAGTTTGGCTATCACCAGTTGGTCGCCGTACGACGCCATGTCGTGATTCATGAGTGGCTTTCAACTTGGCGAGG
TTGGATCGGCGCCGAACGTTTCCTTTATCCGTAAAGAGCCCGTTAGGATAATAGAACTGATGGAACTTATCCCAACAGGTTGATGTCGTCGACGGACACA
TCCATGGCTTGGCGGGAACATCGTGCACGACACGGCACAAACACACACCGTGTCGGAGGCAATATGTTGTCACCTCTGTCGGATATCGTCTCTCCCATCT
ACACACGATGCATCGGCGACGCTTTCTGCTTTTCTCGGCATGAATTTGCCTAGATGACACTGAAGCGCACGCAGTTATTGCAGTGACAGCAGCATTTCCT
CCACACTGCTGAGACGAAGGCGTGGAAACCTGCTCTGCAGCTTCGTCGTCAAGCATTTCTCCATTGTATAACATGCGGCCGTCGCTCGGTGCGTTCCTCC
ATTGCCCATTCAAAAGTTCTCCTATTAGCTCCATTACAAAGCTTCTATGTGGATCGCGATTCGTCGGTTCTGACTTCACCAACCGCCGTGCAAGATACAC
ATTAGCTCTCGCCAGATCGATCAGAGCAAGGGCCAGCTTTTTGTGCCAACGTTTATATGAATGGCCATCCGCAATAGAAAATCGTCCTCGAATTTCGTCC
AGCCTGTCAACACCTTGCATGTTGGCGTTGTATTGGGCGACGCACGCTGGCGCTGGAAATGACAATTTTTCACTGCTGATCATGCGGGTTACAGTAGTAA
TATTGGACGCGTCAGCATTAGACAGCATGTTTACGACATTACCGTCACACCACGACGCTGCCAGCATGCTGTGGTCATGTGAGACCGCCTGGCGATAGTC
TCCACGAACGCAGTCGTTTTCAGGCAAAATACTGTGGACAGGGTAGTGTTTGCTAGTTGAGCGGACAGTTCCTCGTCCATAGAGACCCTTCAGGCGAAGA
CTCTGCAGCAGCTGAACCGACGTGTAGTAATTATCCATGTTGACAATACGATTCGTACCAAACAGCGGCCTCGTCACCTCCAGCACATGCTGTCGGATTT
TTGCTTTTTCCAATTTCTTCAGCTGATCACTCATACTTTGTGCTTCCGAATGATCGACTACACCATTCAGTCGATTCAACACGTCACTTCGCTTGCAATG
AAGTTTGTAGTTTAACGCGATCCACGTCGTAGAACAGCACACCATATAAAACTTGAAATGGTACTTCCCTGTTGGTTTCATGGGATTGTACATGATCATG
TGACGACCTTGGCGAGAGCGGCAGGCGACGCTGGCTTCATCTAGCGCAACATTTTGCCCTACGTGAATATACTGACCTCCAGTAATCTTCAGCAAGTTCA
AGAGTGGCCTGATACGAGCTGCTCCATCTTGGGCGAGTGTGGTAGGCGTAGCATTGAAGCTCAGA