Description :
From Genome Similarity Track
Location :
Scaffold_18:108664- 112731
Transcript NameFunction/comments
Physo_131911reverse transcriptase

Sequence
4067 bases(100 bases per row)
CCCACGTGGGCTCGTCCTGATCTGCCCACTTGATCTTGAATTCACGCACTGAGCGTCCCGTTCTTGTTGACATGGGCATCCGATCATCCAGAATCTCCAA
CACTTCGCTCTCACCGGCCAGACTATCAGGTTCCCAGCTGTCTTCGGGGAGTAATTCCTCGTCGAAGTCCAGCCGGGAGTCTTCGGTGATGTCAGGCGCC
AGTCGAGTCTTTGGGCGGTCTTTGAATTCACTCACCGGCTTCAACCGCGAGACATGGACTACCGGGTAAAACCGATAGCCGTTCCGGTTCGGCAACTCGA
GCTCGTAGGCGTACTCTTCGACCTTCTTCTTGATCCGGAACGGGCCGTGCCAGCGGTGGGCCAGCTTCTTGGCCGGCCCCGGCTTGACACGTTCCATGTA
CAGCCATACGCGACTACCCGGCTCGAATAGAGACATCGGCGCGTTGCTTGAGGGGTCTGAGTCCGCGTCCTGATTGGTTGGCGTTGCTATCGACGACTTG
TTCCTGCCAGTCGTCGGGATGGTTGCTCTCTCCTTCCGGCTCAGTGCTTCGTTATGTTCGCGTGCTCGGCGGGCTTATTCAGTCGCTTGGTATTCCTTGG
CCATCTCGAGTGCAATCTGGAGTTGTCGGTTGACGTCCCGGTGCCACGCCAGCGCGTCGGATTGTCTGCTACTGCCCCTGCGGAGCGAGGTCGACATCGC
TTTCAACATCGACTGAGCGTCCCATCCATGGACGAGGAAGAATGGAGTTTCCTTCCGTGTCATGTCTTGTGAGTTGTTGATCGCGAAGACGAACCGTTCC
ACGATCTCGCCCCAATCCTGCTGAAGCGGGTCTTCGGCGTACACTCTCACGGATTGAATCACCGTCTTCACCGACCTCTCTTGCTGCCCGTTGGCTTGGG
GCCGATAACTCAGCGTAGCCCGCGACCTTGACTGCATCATTTCGGCAAGGGCCTGGAACACCTCGCTCATAAAGCGAGGATCCCGGTCGTGTCTAACCAA
CGAAGGTGCTCCGAATCGTCGGTATATACACTCTTCGAAAGCTTGGGCTACCTTGAGCGCTGTCGTGTCCGACATTGCCTTGGCGATCACAAATCCCGTG
AACGCACATTGGAATAGGAGGAGGGCAGTGTTGCCTCTCCGAGTCATCGGGAGCGGTATTACGAAGTCCATGGACACAATCTGGAGTGGTCGCTCTGCCA
ACACGTTGCCGGGAGAATACCCTCGCAACTGTGGTCGGCTTTTGCTGGTGCTGCAGTCCGGGCACGACTTCACATGCTTCTCGACGTCTGTGTAGAGGCC
GAACCAATAGTAATCCCGCTTGACTCGCTGGTAGGTCCGCACTACCCCTTGGTGCCCGCCTTCTAGCGAGTCATGGCAGTTCTGCAACACTTCTTGAATC
ATTGTGGTGGGTACCACGAGACGCAGCTTGATCTCCTCTTGCTCTCCAGACGTGTCTCGACGACTCGAATTCACATTGTAGAGTACTCCGTCGTCGGACA
GAACGAACGTGTCCGCAATTTTCCAGGCATCTCGTGCAGCCCTGTACCCGAGCTTCTCGACCTCGCCTCGGAGGACTGTTTTCAGGTTTGCCCACCGTAG
TTCCTCGTCCTGAGCGGCTGCTATGCGCCGTCGCCTCTCCACTTGGACATCGACGGGGTCAATGTCTTCTGCGTTTGGCGCTGCGGGCGGTGCTTGAGCT
GCTTTCGATGGTCGTTCATCAGTGTGCTCTTTGTCGGTTTGAGTCATCGGCTTGGGTGGCGTCTCGTTGGTACTGTCGTCCGCAAATCGGACTCGCTTCG
TCTTCGATCTAGCTTGTGAACGAGTCATCGCCATGATCCTGAAAGGTTCTTTGCGCACGAAATCAGCGAATATCCTGGGTTTGGTGACCTCGTATCCGTC
CGCAATTTGAATAGAGCCTCCAGGAACATGGTTTTGCACTGTTGCTTCATCTCGCGTCGACTCATAGATCACTTCCTGGATGCGGTTCAGTTCGCAGAGC
TCTGCCTTCCGAGTTTCACTCAGGACCACCTTCGACGTCTTGGATTCAAGTGTTTCCGACGCCAATGAGTCTGCGGCCGCATTGAATTCTCGAACCATGT
GCAGGTACTTGACTGACCGCAGTCGTGCCGTGATTTCCTTATGGTGACTCAGCTGAGTAATCAGCGACTCCTTCCGGCATGCGATCACCCCTAGGGATTG
CTGGATCGCGAGCCTCGAGTCCCCGACGATGACCAAGTCTTCGGCGCCATGGTCCAAAGCTGCAAGGACTCCGTTGGTGATGCCAGTGCACTCCGCAAGA
TTAACAGTCGTCTTCTCAAGGTAAGCCCTCGCCGCAATCACTATTGTCCATTCTGGTAGGCGCCACACGATCCACGAACAACTGCCATATCCACCATACT
TCTCGGTCTTCGCGGAGCCGTCAAAGGAGACCACAAACCCCGTGTGAGTCTTCGGGAGACGTGCGTACAGGAGGTTTGGGTCCATACGAGTCGTCGGCGG
GCCTTTCGTTGGTGGAGCAACCAGGTCCAGCGAGTCATCGAGGTCCACAAAGTTGGTTACCGTCGACTGGAGCAGTTGTGAAAATACGCAGTCCTTCTCC
TTCACGCGCTGGACGATCAAGTGCCACGGGGAAAGCAACACGGCGAATTGCACCGCTCTCCCGAAGAGTGACTTGGACTTGGTGATCCATTCCAACGTTG
AGAACCGCTGTACACGCGGATGGTCCGTCCCGCTAGCTGCGTATAGCAGGTCTTCAGGAGCTGGAGTAGAGCCAACGCCTCCTTTTCTGCAGGATGGTAA
TTTATTTCTGCGTTCTTCAAGACGCGACCACAGAAGCGCATACGGTGCAGTTTGTCGTCGTGCGTCTGGAGCAATGTCGAGCTGACTGCCCATTCGTTCG
CGTAAAGCATCACGTGCACGTCCTTCTTCTTATCGAAGTGCCGAAAGATCGGCGCCGCCGCCACCTTCTGCTGAAGTGCTTGGAAGCTGCGGCGGGCTAC
AGCGAGGTCATCCCCGGGCGCGAAGTCGTCGTCCTTGAGCTGGTACAGCGCGGCTCCATAGACTGCGAAGTCTTGGATAAACCGGCTGTAGTAATTCAGC
GCTCCGAGGAAGGACTGCATCCACTTTTTTGTCCGAGGGAACGACAGCTTCGTGATTGCGTCCAGTTTCTTGGGGTCTGCGCGCATCCCATCTCGCGAGA
TCTCGTGCGACAGGAAATCGACGCCTCCTTGCACGAATATGCTCTTGGTGAAGCTGACGCTGATCCGGCACTCCTCAAATCGGCTCAAGAGCCGGTTCAG
CGTGGCAAGACAGTCTTCGAAGCTCTCACCTCCGAAGCATATGTCATCCACAAACGATCGGCGATCAAACACCGGAACCAGTGACGAGTCGTCGGGCTCG
TTGGTCGCAAACATGTCTGCATCCGGGCTGTTGATCAGCAGCAAGACAGGATCTAGTGCCTGCGAGTCATCGTGCGGGACGCTGTGGAAGGGTTTTGCAG
GTATCTCGACGACTCGAGTCGTCGGAGACGTGCTGATTCGGCTTTGGCAGCTCCCATCTGTTCCGCAAAGGCCTTCCAACCTCCCTTCGGCTGGACATGA
CCCCACAACGCGTTGTCGATCATGCGCTGGTAGATCATCGGCGCGTTCTTGAGGCCGAAAGGCATGCGAAGCCACTCGAAGTGTCCCAGCGGGCAGACGA
AGGCCGAGATCTTGCGCGCTCGTAGCGTCATCATGATGGCCCAGAATCCACTCGCAGCGTCGAGTGAGCAGAACCAGAGGTATCCTTCTAGGTCGGTCAA
CAAGTCATCGACGAGTGGCATGGCAAATTCCATGATCGCTGTGATGGCATTGACCAGCTTGTAGTCGATGCACAGTCGAATGTCGATCCCGTTCTTTATC
AGGACGATGACGATCGGCGATGCCCACGGGCTGTCAGAGAAAGACACGAGTCCGGCCTTGAGCAGCCCCCTCAGCAGCTCATACAGCTTCTTAAGATGCC
GTAGTGGTATCCCCGGGCTCGTTGCTTGATTGGCGCGTGCCCTTGCACGTCTATGCTGCCGACGGTG