Description :
From Genome Similarity Track
Location :
contig_27:108648- 109961
Transcript NameFunction/comments
g5911.t1hypothetical protein

Sequence
1313 bases(100 bases per row)
TTTCAACACTCCTCCACGCCGGCAGCGGCGACCTCCCTCGTCTCAATGGAGACCTACGATGTCCCGCAGGTTAGCCAGTCTCGGTGCCTCCAAGGCCTTG
GTGAGGACGTCTGCTGGCATCTTCTCGCTCTAGGTACTCGGCCTTGAGCACCCCGCGCTTCGCAAGCGCGCCCACGAACTTGATGCGCACATCAATGTGC
TTCGCCTTGCTCGATGAGCCTTCACCGTCGAGCTGCTTGAGCGCCGCTTGATTGTCGACACGCAGCGACATCGGGCTGGCATGCGTGATGCCCAGCTCTC
CAAGCTACTCGCGCACGCCCAGCAACTCTGTATCCATAACCGAGGCCGCAGTGTACTCAGCCTCCATGGTGGAGAGGCTGACGCCGGTCTGCTTCTTGCA
GATCCACGACACGGGCATCCCGTCAACCGTGAGAAGGCCGCCGGTCACGGACTTCCTGTCCGTCTTGTCGACAGCGAAGTCCGCGTCGCTGTACGCGATG
ACCTCCAAAGCCCATGGCCCTTCATGCTTATCCGCAGACTCTTGGTCCCTGCCAAGTAGCGCGCGATGCGCTTGCCGAGCTTCCGTCGGACATCGTGGGG
CTGTGGGTGCGTCGGGACGCTTTGTGCACCGCGTACGCGATGTCAGGGCCCGTGCAACGCGCCCTGACACATAAGGCTCCCCACGAGCGACTGGAACTTG
CGTACTGTCACCACGCCATCTCCTCCAGTTGTGGGCAGAAGCTCAACTGACGCCTCGTCGATCTCGTTCCACTCGGCGCCGATCGGGGTGCGCACGCTGT
GCACTGACCCCATCCCATGCTCGCGCAGCATCTCCTCGATGGCCAGCTCCTGATCTAAGTCGTAGCCCTCGTCCTCGGCGTATGACACCCTCATGCCGAA
GAAACTTGCTGGCGGGGCCGAGGTCCTTGATGGAGAGCTCGGTCAGCTCGCCGAAGAACGCGTCGACGGCTTGCTGCTGCATTCCCGTGACCAGCAGGTC
GTCGACATACACGCCGACAGCCACCAGGACGCCTTCCCGGCGCCTGTGGTACACGCACATGTCCGTCAGACTCTGGGCGAAGCACAACTTGATGAGAGCC
TTGGTTCCAGAGGCGGGCTGCCTGCTTGAGGCCGTACAAAGCCTTCAGCAACTCCAGCACCAACTCGCAGTCGTTGGTCACGCCCAGTTGCTTACGCACG
TCTTCTGGAATCACCATTCCGCGCGGCAGGCGCAGGAAGATGTCCAGCTCCGCCTCCTTGTCGGCCTTGACGTACGCGTTGGGCACGTCGCCGTGCTTCG
CGGGGACTCGCCA