Description :
From Genome Similarity Track
Location :
contig_34:10863- 14868
Transcript NameFunction/comments
g6554.t1hypothetical protein

Sequence
4005 bases(100 bases per row)
GCAACCGTCTTGCACCCGTATCCACCTCTAATCAGCAGCTTTTGCTACTGATTGTCCTCCGCCACCTCGTGTGATTGCATCACCCCGAAACGACTGCGGC
TAGTGCGATTCCGCTCAAACTCATACAGCAGCGCCCCGCAGTTGAGATCAGCTTCGTCCACCCACGATGGGTCGGCATAGCCCTTCCAGTAGATTTGGTA
TTCTCGATGGACCCGCCCGTATCTGGTTTTGCGCCCGGATCGGACGTCCACGATCTTCTCGACTTCGAATTCGTTATCACCCAAATCATTCTCCCAGCTA
TCTTCTGGTAGAAGTGCTTCATCGAAATCAAAACGATTTTCTTCATGGGTGGTTAGCGTCGCGTTTGGTCGATCAGGAAAACTCTTCACCTTCTTCAACT
TGGAGACGTGCACGATCGGAAACAGGCGATACTCCGTGTGAGCTACTTCGAGCCGAGCAGCATAGCGACCGACCATCTCAATCACCCTGAATGGTCCATG
CCACATATGCGCAAGCTTCCGGGCGTAGCCCTCCTTAACTCGGTCGAGGTACAACCACACTCGCGTCCCAGCTTCAATCTCGTGGGGTCTCACGCCTTCG
TTGTGTTGATCGGCTCTAGCTTGTATCGCGGCCTTGACACGTTCGTTCACTTCCTTACGCGCTCGCTGGTATTGCTGTTGAATGTGATACCGCCACCTTC
GCGGCTCGTGGTCACACCTCCGCGTACTGCCGAGCGGCAACGACGCCTCCAACGTTGATCGTGGGTCCCACCCATGTACGAAATAGAATGGCGTGTCACC
GCGCACCCGATCGTGAGCGGTGTTGATCGCGAAGGTCAGCCTCTCGGCGTACTCTCCCAATCCTGCTGATTCGTATCTGCGACGTACATTTTCAAGGCGC
GAGTGAGTGTCTGCACCATCCTCTCTGCCGTGCCATTAGCTTGTGGGCGGTACGCCATAGTAGCGCGCTGTCTCTGTCCCATTATCCGGTTGAATGCGCG
GAAGAAATCAGACATAAACCCGGGTTCCCGATCATGGCGGATTGCCTCGCTGGCTCCAAAACGACGGAAGACACATTCTTCGTAGTTCTCTGCGATGGTC
TGTGCGGTCCGCGAAGCACTAGCCTTGGCGATCACATATCCCGAGAACAGATCTACCCACACCAACAGCTCCGTATTGCCCTTGAAAGACTTCGGCAGAG
ACGGTATATGGTCCATCGCAATAATCTGGAATGGGTACGTAGCCTGTACGTTACCTGGCGACTCACCCTGTACCACTGGGCGCCCTTTCCCAGTCTCACA
ATCCAAACATTCCCCCACGAATCTCTGGACACTCTTGAATAGGCCTCGCCAGTGGAAGTGGGCCTTGATCCGCTGGTACGTACGGCCGATCCCCTGGTGT
CCGCCCTCCAAACTGGCATGATAATGATGGAGGAAATCTTGATGCAGGGTCGCGGGGACTACCAAACGCGCCATCGAGTCGCGGTTTTCGTCGGTCCGCG
TCATGTTCCCGCAATAGAACAACAGATCGCCTTCGCCTACGTCGTAGTCTCCGGCGATCTTCGCGCACAGCCTCGCATCTTTGGAGCTAAGATCGGCAAC
GTCTCCTCTCAGGTAAGCCTTTAGGTCCCCGATCCACTTTTCCTCGTTCTGTGCTCTGGCGATCCGCTCACTTCTCATGCGGTGTACGATCGTCTCTTGC
AGCGAAGCCGATACTTGGCGTGTCCTCCTCGCTGATCGCGTCACGGCGGTCACCTGGACAATAGAGTCATCGTTTGCCGTTTTCAGCACTTCACCTAATC
GGTTGATCGCGATCAGATCGTCGATCTCCCCTTCGGCCGACACAATCGCTCCTGCTTCTCGCTGTAAGGCAGTGCTTGCTAGCCGATCAGCGCTTTGGTT
CCAGTCGCGTTTCACGTGGAGTAGGTCGTGCGTCGGCCAGGCCTTCAGTCGTCCCATCGCCTTCTCGCGCAGCACCTGGAGTCCCGGCGCCTTACAGTCG
ATCTCCCCTCTCATTTGTCGGATGATCAGGTTGGAGTCTCCACAGATGATCACCCGCCCCTTGTCTTGGTCAGACAGGAGTTTGAAACCCAGTAGCAGAC
CGCGGTATTCGGCTTCATTCACCGTTAGATCAACGGTGAACTCTGACGCAGCGGCTACTATGGACCATTCGGGTAACTGCCACACGATCGCGCTGTATGC
TCCCGCGCTCCTCTTGACACGTGCCGAGCCGTCGAAGCTTACGACCAGCAGTCTCTCGTCTAGACCCACTGTGGGTGGAAGCTTCGCGATTGTCTGCTTC
GGTTCCTTAACTGGGGCTATGGCGATCAAGGCATCGTCCACCTTTGACCGCGGAGTGATACTGGCGGCGATCGCCCCCAGTATTTCGTCTTCTCCTTTGG
TGCACTTCCTGATCTCCATCGTCCATTCCGACAGTAGAGCGGCCCAACGTCCTAGACGTCCTTGGAAACCCGTTGATTTCAAAAGCCAAGCGAGTGTCGA
GTATCTTGACAGAACTTTGATTGATCGGTTGGTCAGGGTGGTGTAACATACGTCCAGGATTCGAAGAAGTGCGAGCACTTCCTTGTCGACCATACCGTAA
TTCAACTCGTTCGACTTCAACGTACGGCTCGTGAAGATCACTGGCCAGTACGTTCCTTCGTGCTCCTGCACCAGCGCAGCAGAGATCGCCCACTTATTCG
CATATACGACGATCACCGGTTGGCGATCAGAATCGAAGTGCCGTAAGATCGGGGTAGTTACCAGCTTGGACTTCAGCAGATTGAATGCTGTCTTCGCACG
GACCCAGCGGTCGTTCGCTTTGCCTGTTTGATCGGCATTTCCGATGCAATTTATCTCATGGAAGTCCACTTCACGAAGTTCGTACAAGACCGCCGCATAC
ACCGCGAAGTCCTCGATGAACCGACTATAATAGTTCAGGCTCCCGAGGAATGACTGCATCGATCGCAACGTTTTCGGGAATGGCAGCCTCTCCAGTGACT
CGAGATCTTTCGGCTTGGCCTCCAACCCTTCCGCAGACACTCGGTGACCAAGGTAATCGACCTTGCGATATCCCCAGAAACTTTTAACCACGCTGATCGA
CAAGTTCCACCGATCACAGGCGTCAAGCAGTTTTTCTACTTTCTCGCAAACGTCGTCCCAAGAGCCGGCAGAGATCAGGATATCATCGATGTATGATCGA
CGCCCCAGCACTGAAGGTCTCGGTTCATCCTCGGGTTCGCCTTCCTTGAACACGTCGACCAGCTTGGATGGATCAGCGTTTGGACTGATTCGGAAATGTC
CATACAGCGCGTTGTCTATCAGTCGTTGGTAGATCTGTGGGGCATTCTTCAGGCCGAACGGCATACGCGTCCATTCGAAGAGGCCGAACGGCGTGACAAA
GGCTGAGATCTTCCGAGCGCGTTCTGTCATTGAGACTACCCAGAAGCCACTTGCCATATCCAATGAACAGTACCAGAGCGCTTTGTCCAGATCCTCCAAA
AGATCGTTGACCAAAGGCATGGGGTACACCATCAGGCGGGTGAGACTGTTGACCAAACGGTAGTCAATGCACAGCCGAATGTCGACACCGTTTTCTTGAT
GATGATCACGATTGGTGATGCCCACGGCGATGTCGAAGGTTCGATCATCTTTGCCGACAACAGACTTTTGATCAGCTCGGACAACTTCTCTCGGAACTGC
GGAGCTACACGTCTGACGCGTTGGGCCACAGGCGTTGCTCCTCCAACATCGATATCACATACCGCTCCGTTCGCGGCTGGCGGCAGGGCATTTCCTTTGC
CGATCAGCAAGTGACGGCGACGCCAGATGATTTGCCGCAGGCGATCAATCTCTGGGGTATTCGCTTCCGAATCACCCACTTGGATGTCTTCGATCGAGAC
CTCGTCGGTTGAGCTGGACACCTCGGGAAGGATTGCCATGTGACCCTCTACGTCTTCAGCAAACAGATCGCCACCTTCGTGTAGGCATACCTCTTCGTCC
TCCGC