Description :
From Genome Similarity Track
Location :
Scaffold_92:108608- 110968
Sequence
2360 bases(100 bases per row)
ACTGCGTGGTGTTTACTAATCCAATGATGTTTGTAGTATGCGCAGGCGCAGGATCTACAATGCGCCCGGCGGCTTAAGGTTGTCAGTATCGTTGGATGTG
TTCGTTTAAATGACTAGCTTTGTGCAGCTTGCGCATGTACTTGAGGACGTTTTGTGCTCCGCGTGCTTTGATTGTGCTTGCCAAGAAACGAAAGTAACCG
CATTTCGGTGACATTGCCAAACTTCAACACTTCGTCTCGATACTGCGGAGACTTCTCGTCAAGCACGAAGCCATTAGCGCGAAACAGATTCATGAATGCA
GCGACAAGTTTAATGGTGGATTTCGTGTGCTTTCTATAGCTGTCGAACGAATCCCAGAGGCGGGGTTCTTGGGTATACCAGGAGAATAAGCCGTCCTTCA
GGTTTGTTGCTGAACTGGTTGAAAGACGTTTGGCTGGTGGTTCTTTGCTTTTATCCTCAATTCTATCTTGTGTAGTTTTTGGCTGTGCTATGCTAAAGAC
TTCAGTTTCCATCATCGAGACACGCGACTGGTTGATCTTGACTAACTCTTTAATTAATGAAGATTGATGAAGAAAAAATTGGGTGCTTTGTGATGTCTAT
CATGCTGTTTTGAGCCTTGATGGGATTTGGTTGCATTATTGTCGTCGTGTAGTAGGTTAGATGCGATGACCAAGCTAGAAGATTGCTGACGGAGTAACCT
TGCCGGATGACACACGCTTCCAAACGTATGACTACAAGTCCGTCTTTCTTGAGCTTCTTCAACAATGATAATGACGCAGCCGGTAAGTGATAAACGTTCA
AATACTCTTTTGTTTACGTTGTACTGTGTAGTCGTGAGCTCGTGAGATGCATTGAAGAGCGCTGTCGTAACAGCTTGTATCTTTGTCTGCGTACCGGAAT
CAAAGACATCACGTGATAGGTTAGAGATGTCGGTATCGGGTTGTCGCCCACTCAATACCCGATCAACCTTGTGGTCTTCTGAAGCTGTATTAAAGACGTA
CGCGAAGTCCTTGTTTGTCGCTGTCATATTTGAAGCCCCTCGGTCGAAGATCCACTGTACACACAATCCAGCCCCATTTGCATGCTGCGCCCCTTCCGCG
CCGAAAAGAATGAGATGTTAAGCGCTCGAATACGCCAGCATTTTTGCCGCGACCCGATTAAGAACACGGTTATCGTAGCTGTGCACATCAGGAGCGGTGT
CTGGGCAGTTCTCCTTCTTAGCAGCGGTGGACGATGTATTCGTTGAATACACCACAACCTGGGTGATTGAGTACATCTATCAGCAGAATTGCTGGAGCTA
ACTTGGACTGCGAAATAGACGTCTGCTCAGAAAGTTGACTCAGCGCAGATATAGTTGGCGTTGAGTGGGTCACGAGGGCGAGCCCTATGGCAATCCGAGG
ACATGTGGCGAGGTCTTCGTCAGAAAAGAGTGACATACCTTGCTCTTCAGAAGTCTTGATGCGGATGCAACGGACGAAGGATATGTCGACCGAGCCGATA
GAAAAGTTAGCCTTCCGATGCGCGCCCGAGATGAACCAAAGCAGACACAACAGCGCCGCATCTTGGTATTCAGCACTAGTAACCGCAGTTGAATACAAGT
ACTCCATTTTTTTTCTTGAGAGCCGACTTTGTGCATGCTGGGGCCTTGTTCACAAACGAGCCTGACTCACGCTTCATGCAACGGTGTTCGAGCGTCTGTC
CCTTCTTGAGCAAACTATTTTCAACCACTGCTCGATGTTGTGCAAAATGTTCCAGCAACCAATTATTGGCCTGTCAAAAGTACTGCATTACCAGTGTAGA
GCTAAGATCTGTATCTTTCGTCCCTCCTTGAACGCGAGATACGTGCTTAACTTGTCCATCACAGCTTCTAAGGAGAGAGGTATCCTCTCGCGCTGCATGC
ACTGTTGCAGGTTTTTCCAACTATCCACTTCCTCCTCGAAGAACTCAAAAAATGAGCGCGCTGCTTTCTCACAGGCACGCTTCACGTTAGCAGGTGCGAG
GTTGGTCAGACTCATCCTCGGCGGGAATGTTGAAGCTTGGATGTTTTTTGTAAAATATGCGATTGATTTATCTTTTGTCGGAGATGTCGGAGCTTGGGTG
TTATTCTTTAAAAATATGCAAGTGACTGAGTGTTTGTAAGGTGATATCAATAACTGCACTGCTCGGTCCGACCCGATACGTCGGAAAGGTAATCTATGAG
AGCTCACTTGTCCATCGGCTCTCTAATTGGTTATAAATATTACCTTTGTCCGATTTGGCTCGCTTATAAAGGTTTTTATATCACCACGCTCACCCTATTG
GGTCAATACAATCAACACGTTATTCAAGTGCGGTCGGAGATTTTATGTTATCCATCCATA