Description :
From Genome Similarity Track
Location :
Scaffold_419:108575- 110251
Transcript NameFunction/comments
Aphin_H310_00866PREDICTED: PAX-interacting protein 1-like

Sequence
1676 bases(100 bases per row)
GAGGTGGGAGGCCGATTCTCGTCCGAAGCCGAATCACGCTCATGTTGTGGAATATGACGGCGTTGTGGTACTGACGGGGACAGAGTGGCATTGGATGATG
CACAGTCGCCCTTGTTCGAAGCGATGGCCTCCGTCTCAGGCAAAGTTCGCGGTGTGTTAACTCGTGCGGTTTCAGAAGGGGCAGTTGAGGCTCCGTCGGA
AAGGATGGAAGCGGGGCATTGCAATGGGAGATTGTCCTTGTTTTGAGATGAACTTCGATGAATGGGTGAGGTTGTGGGTGCTTTTTTGAGGCCAAGATCA
ACTGGTGTTGCGCTGTGGCGTCGACGTTTCCGTGGCGACGAGAATGTCGAAGCTGGCATGGTCCGCTGGAACAGATCATCGTAAAAGGCTTCGGGATCCG
CCGGCGTGGTGACAGCGCGTGATGATGCACGAGTGGCAAGTTCGTCATCGCCTTCGTTGTCTTCTACCTCCGTGTCCACATTCCCGGTGTCCGTCGCAGC
CGGGTCCTCGGGAGCATCAGCGAGAGGATCGGCCATCGATGTTGCATCGGCGCGCTGTGTATGGAGAGAGGTTTCAGAGGTTTGTTGCTGTTGCTCCAGT
GTGGCATCTCCGCCAGCCCATAAATCTTCGGACTCGTTCGAGCTCTCGCCATCGCCCAATTCGTAGTCGAACTTGTTCAAAGGAAGCTCCACCTCAGCCA
GCTGCATCACATCTACGTTGTACACATCGTTGAATACAAATGTATAGCGTGCGGCGACTGTACTTTTCTTGGAATGGTGCATTGGTGACCCCACCTCCTG
CGAAATGACGTTGGAGCAAAATTGGATCTGGGTCTCGTCCTCGTCATACGTGCACAGCGGCAATGCCCGTGGAGGACTCGCCGGTTGAAGGGGTTGATCA
AGCCCTACGTAGTGCTTCTGCCACTGGCTCGGGGTGTTTTGTGGCCCAGCTTCCGTGCCTGCGGTTGTGTCATCCGCAATCGTGTCATCGTTGTCGGTGG
GTGGCGCATCCATGATGGTATGTGGGCATCACCAAAGCTAAAAAATGACCAAATTGCGTCGAAATCCCGCAAAAACCGTTGAAAAATAGTATGAAAACGA
GTGGTGAATATTGGGAAATTCGTGTGAATACTTGAGTATCTCATGAAACGGCTCAGCCCCGACGCGTAACTGTCTAGCTCAACGAAATCAGTTACATGAC
TTCATGCGCCAGAAACGACGAAAATGAAAACCATCCAAGCAAGTCGTCGATGCTCAAGACAATGCAGAGCAGGCTGCGCTAGCATGTGGCACCACGGTGG
CGACGGACAGTCTGGGTGCCTCGCCTACGACGAGACGAGCAGCGACGGCGCATTCGATGCAAGGACTGGTCCTGAAAGCTTGAGCGCGCTTAGGTTTTCG
CTTCGTGCACTGGTCATGATCGTTGACTACCTCGAGTTGTTGTCTGGCACCCTCTTCAATGCTTTGTGGTGGCAGTTGTGGTCAACACTCTGTTGACTCA
ACGATGCGTTACTAGCAACCAGTGTGACCGTCCTTCGACCTCCTTGCAAGGGCTTTCTCAAAGACCACTTCAAATTCACCGATTTTGCTGTTGACGCGCA
TGCGATCGGCCGAGTGCATGAGCATCCATTTGTGTTCATTAGACTTGGCTCGGACGTGGGATGTTGCACCCACGCA