Description :
From Genome Similarity Track
Location :
Scaffold_30:108512- 116207
Transcript NameFunction/comments
Physo_156837hypothetical protein
Physo_134121ATGSL10 (GLUCAN SYNTHASE-LIKE 10); 1,3-beta-glucan synthase

Sequence
7695 bases(100 bases per row)
CTTGAGCTACCCCGGTCGTGACTACTGTAGACACCACGAGGGGTATCAAAGTTACAAGGCCTGACAGTCCGTGATCGTCGCTCCAGCTGAGGCTCGCGGA
TCACTTTTGACGCGCACAATATTTTATGCACCAGTGTAGTACTTAGTAGTAATAGGATGTTTCTCGCGACCACAGCGACTATTTTGTGGTTGCTTCAATG
TCGCTCTGTATTCTATGATGCAAGCAATCTTCGGAAATTGCAATATTGCCTTACACTCTCATTCCAATTCGATCCCGAAAAGTGTACGCAGATGCCACTG
CTACGACGCCTATCGCCACGGCCGAGACGATGAAAGAAGCCTGTAATGTAGCAAGACAGAGCACGCCCATTGAGTTGGGTAAGAATGCAACCTACGGACA
CTTGATACGCAGGTAGCGGCTTACCTGCCAGGAACCCAGTACATAGCTCGATTTGTCGCCATCCCTATTCATGATTATGATGGCACGGTGGTTAATACTT
CGAAGTAAGAGCACACGCCCCACCATGCTGGGACTAACCTTTCTTGTCGAGGAGGCAGCGGCGGAACCTCTTTTAGCATTGGAGCGGTCGCGCTGGGCCA
CGGCTGGTGCCCGAAAGGGAACTGAAAATACGTGTTGGCTCTGCAATTTTGGGAACGATAAAGGTTAGGCAACTGGAATTTGACAATGGAGAATTAGATA
TGCGTACTTTGAGGCTGATTCAAGTTGAGCCCGCTGAAGAAGCTGTGGCGGCGGCAGTTGGTGAAAAAGTACAACAGCCCGCGCGATGACTTTTTCAACA
TCCATGGCGAGGGGCAGGCTCGAGAGCAACCCGTGCATCGTGCCGAAGTCACGTTCGCAGCGAAGAATCTTGTCCTTTGCCTCAAGTAGAACCTGCATAT
CGGTCATTTGCAATCCGTCAGATGCAAATTTGTTTGCAGAACTGTCAAACCAATTCGGAGACGAGGGATGACCACCTACAGCAGCGGATACATATAAGCT
GAAGAGCGGATGGGAGACAAGAAACACGTCGTACAGCCGCGCAACATCCTGGAATCGCCTCAATTGATGCGCAAACCACGTGATCATCCACGGCAGAGCG
AAATACGGTTCAACCTGAGCCAGACACGCAAAGTTTGTCAGCTTGGCTCCGCGATAATAGTTGATGTGCACCAGAACTCACCCCCGACTCGTGCAGATGC
TGGTAAAGCAGCTCGTCAGCCGCATCCAGCAGCGGAAACAATAACCTGGTCGTCGCCATGACTTGCTCGAATCCCGACCGCATCGGTTCACGCTGGTACG
TCTCGCTCACAGTTCGCACCGCTTGCAGCGTTCCCTTCGAGTTGCCCAGTGTCAAGAGGAACACCGAAACGATATCGTGATACCCCTGGAAGTAAAAGAG
CTCGTCATTGGCGCCCAGCACCCCCAGAATAATGTGCGTGAGCGCCCGGCGCTTGACGCGGCGCTCGCTCTCTTTAAGCCCTTGCAGCACGTCATAGTGC
CACAAGGATCGCTCCACGTCCTTCTCCACCTGCGCAGCGTCCCGATGAGCCTGATGGGACTGGTTCCCGGTGTTCGAGGAGCCGTTCAGCGCTGCCGCAT
TGACACCCAGCAGGAAGGGCCACAGGTCTCTGCGGAACTCTTCTGAAACCAGGCCTTTCGATGCTACTGCGAGCCGGCGCACTTCGCGGAAGCAGGCGTC
GCGCTCTTCCGCGGCGGCGGCGTCTCCGCGGTCCAGAGCGCGCAGGCGAAGAATGACCGCGCGCAGCTCCTTCTCCTTGTGGCGGATGAGGCGGCGCTCG
CGCTCGGCCGGCGCCCGACCGGGGATGCCCCGCTCGCGGTTCGCGCTGCGCTTCTTGGACATGGGGTCGAAGATACTTCACGCCTGCAACGAGCGTACCA
CATCATTTTTGTATTTTTGAGAAATGTATTTTCAGAAATTTCAAAATGGTCCAATCGCGATCGTGCTGATCTTTGATGTGGCGCGAACACAAACCAGCTG
GGGAAATTAATTGCTCGCGACGGATGCGTCTTGGATCCGTCCAGACAGCGCGGTGGGCGACGCTGACAGCGCTCGCCTCCTTCCTGCAGGGCGTCGAGAC
GTTTCCGCCCCACGTCTCAACGAGATCCACATTGCGCGCGGCGCACTCTTCAAAGCCTAGTTTTGGTGCCAAACAACAGAATCCAGCTGGTCAACACTGA
TTCCTGACGACCGCTTTTTATAGAGGACCCTCGCAGTAATGTACAGGCAGCAATCCTTCCACTTCACCCATTCATTCACCCATTGCACCTTGGGTTGAAT
GGGAGACTGGGTGACTGGGTGGTGAAAAGATGGGTGAAAAAGAGTACCGTAGTCACTTTTAAAAGTACCGTAGTCATGACAAACACGTCTAAGTGCTCGT
ACGGATTCCGTGCCTAAGTGCGCATACGTCGGCTAGCCAATCGTAGCGTTCACGGTTTCGCCGCCGTTCCAAGCCGATCCGCTTCGAAAAGTGCCGTTCC
AGCGAACCCATGTCTGCGATACAAACGCCAAGTCAAACGATCCAAGCCTCAACCAGCGCGAAACCGGGGTCGAAAGCGCGATCGACCAATGGGCGCGTCA
CCTTCATTGAACCAGCCAACTAGCGCGCAAACGCCGTTCCAGCCGCGCAGTACCGTGAGCAGTTACGCGCAGTACCGTGAGCAGTTACGCGCAGGACGAC
CATCGCTTTAGAGAGGTTGTTTAAAACAGTTTGAGAGATCAAAAAGCCCAAATCGTACTTTTCCAGTGGGTGCTTTGAAGCGCACTTACCAACACCCCTC
GAATAGAGGCCCCCTCGAATAGAGGCTCAGGCTGACTCAGGCCTGCAAACCGCACTCGATATCGAAGGTAAACTCTTTGTGACAGGCACCTAGACATAAT
GAGATCAAGTGTTTCCGCAAAGTCGGCAGGATGCGGTCTTGCAGGTGATAGTATGTCAGGATTCTGATTTCTACACCCAAGCACCACTTGGCTTCACTAT
TGGCCCGCCGCGTCCGTTGGTGTCGGTGTCGGCTCGCTCTCAGTGTGGGATATCGCGAGCCGACGGCCAGAGGTTCGGAGGAAACACCCGAGCGGACGAT
CGCTGCCTCGCACGCCGCGCCCACATACAGAGCGCAAGTGTCCCCGCCAGTCGCGATCGGCGATAAGACCTGCCGCCAGCTGGGCAGTCGCACGTGGACC
GAGACAGGGCCCCGAGTCTCACTCGCCTCGCCGCCCGCTGTCTCTCTCTCTCTGCTCCCGTCCTTCGTCTCTCAGTCTTGAACGCCCCGCAGCCCGCGCG
CGACCATGGCGCGTTCCGGCAGCGATGGCGACAGCGATGACGCCATGCAGTACAGCAAGCCGCTGCGCCAGCAGAAGAAGCTCTGCGATGAGGCCATGGA
GCTGGTCAACGCCGGCGTGGCCATGCAGAACGCGTCGCCGCCCGACACGGCCGGCGCGGACGCCAAGCTCTCGCGCGCCGTGACGCTCATGGAGCAGGCG
CTCGCCATCGAGTACCCGACGCAGGAGGAGCGCGACGCCAGTCAGCGCCTCAACAACAAGATGAACCGCTACGTCAAGATGATCCGCAGCCAGCGCGAGA
AGGGCGCGACCGGGGGAGCCCCGGGACGCGGTCACAACACCAAGTACAACATCCTGCCCATGGACAATCTGCCGTCCACGTACAACGTGATCCTCGAGCT
GCTGACCAAGTGAGTTGCAGTGCGGTTTCACCCTTGTCTGATTCAGGGGAAAGACGAGCTGACGTTGTATTTTTAATCTTGTGTGTGTCTACAGCTCGTC
GACGGCCGGTGATATCTTCGAGAGCATGAAGACCACCTTCGGTTTCCAGGAAGCTAATGTGACCAACCAGAAGGAGCACGTGATGCTCATGCTGACGAAC
TTCAAGCTCCAGGAGGAGGAGCCGAACCAAAACGGCGACGAGCACCACCAGCTCGACCACCAGCAGGAGCTTGACATGGCCAACAAGGGTATCAAGCGCC
TCCACGAACGCATCTTTGCCAACTACACCAAGTGGTGCAAGTACGTTTCGACCAAGCCTGCGTTCACGAGCGACCCGCTCGTGGATCTCGTGCTGTTCTT
CCTGATTTGGGGAGAGGCTGGTAACTTCCGCCAGACGCCCGAGTGCCTTTGCTTCCTGCTGCACACGTCGCTTCCGCAGGCTTCGTCTCGTGGCGGCAGC
AAGAATCCTGGCGACTTCCTTGCCGAGGTCATTCGCCCTATGTACAACGAGATCAAGAAGGATAACGACAAGAAGACAGCGCAGGGCGCCCGAGCTTCTC
ACGCGGAGATCCGTAACTACGATGACTTCAACGAGTTCTTCTGGAGCAAAAAGTGTCTGAAGTACAACCCGACGACCATCCACGAGGCATTTGGCGAAGT
GGACAAGAAGGGTCGCCCGAAGGTCATCAAGAAGAGTTTCGTGGAGAAGCGCACGTGGTTCCGCGCGCTGATGTCTTTCCGCCGTATCTTCTGCTTCAAC
TGTGCGCTATTCATGGCTGTTCTCGGATTCTCTATCAACGTGGTGATGTATTGCCCGGACACGCCAATTTTGTACGGCGCCGATCTGAGCAACGGAAACT
CTCGTGGCTTCACCGTTTTCGGCAAGAATATGACGGCATCCGACTATACTGCTATCGGATCTGGCGATGGATCTGGTGATAAGTCGAGCTCGGGATCGGG
AGCTAGCTGTAACCACCAGATGCTGGCGACTTGCCTGGGTATGACCTACACGGAGGGTATTTTCGAGAATATTCCTATTGATTTCAAGGCACTGCTGCAG
CTTGTGCCGTTCACCGACTGCGTGGAGAAATCTACGGGTCGCTGCGGCTGCTACTTGGATTTAATCGACAATTGCTTTTCGGAAACCGGTCAGACTACTC
ACGTCACCGAAGACGAGCTTACGTTTTCGTCATCGAGCGAGTACGACCAGAGCATGTGTGTTGTGAACTGGCGCGCTGCCGTTGAGTCCATCATTAAGGA
CCCGGGTCCGGGTAAGCTGAACTGCGAAATCTGCCAACTGGACATCAAGGCGTTGATCACCAACGGTAAAATCGGTGATCTCATTGCTGGACTGTTATCT
GTTGGAGACGGCACGCCCCTTTCCGATGGAGACATCACTAATACGAAACGGACGGATATGGGTGCGCTTGCCATGTTTGGCGGTGTCGGTTGTCTTGGTC
TCGTCTTTGCATGCGAGTTCTTGAACAAGATCTTCTCGCGTGTTGGATCAGGCTACGTCGGGCGTTCGATGCCAGTTCCAATCCGCGCATACTGCCGGTA
CACGTGTTTTTGGCTTCTGCTTTTCATGTGCAAGCTGACCTTCGACTACCAGTACATGATGAAGGCCCTGGTGGAAACAACGTTGTTCATTTGGTACGCG
AACGAAGACGAGTACCTCAAGTACTCGAACTTCATTCTCCAGGTCACGTTCCACAACATCATCTACATCCTGTTCTTGTGGATTCCGGCGTTCTTCGTGT
TCATGTACGACGCGCAGATCTTCTACTCTGTGCTGTCGGTGATCTTCGGTTCGTTTGCGGGTTTCAACCTTCGCATCGGTGAGCTGCGCTCTTTCCGTGT
TCTTCGACTTTCGTTCAAGTCCATTCCCCGCATGTTCAACAAGAAGATTGTCCCCAACATTCAGGATGGAGCTGCCGATGGCAAGAAGAAGAAGAAGAAA
AAGAAAAAGGGTGAGAAGGAAGAGTCAACAATGCCCGTGCGTCACTTCGAGCGTGTGTCAATGGCTGACGGAATCAAGCCTCTTACGGTGAAAGCTCAAA
TGTACTCCAACCTTCTGGATCAACATGGAGAAATGTACAACGAAGTCAAGACGCCCAATGACAAGGATGACGCAAGCTCTAGCGGCCGTCAGTCTCAATT
GGGTTCAGTAACCGGTGTCTCTGGCGCCGACTTCGAGCGTACTATTCCTTTTGCGATGGCCTGGAACCGTTGCCTCGGCAGTTTGCGCGAAGCTGACGTT
ATCAGCGACCGCGAGCTGAACGTGCTGAGCTACTTGATCGACTCAAAGGACGCAGAAGACCGCAAGTTGTACCCGCCTGCTTTCTTGACGGCCGGCAAGC
TGGACGAGTCTCTTGATATCATTGTTGATTGCTCAGCTGTGTACGAGAAGCTGAGTTCCGACAAGAAGAAAAAAGAAAAGGCGCTGCAGAAGATTGAAAA
CACGATGCGCGAGCGTCTGACCAAGGACGATTTGCGTGTGGAGTCGATTCTCGGATCGTACAAGTTCACTTCGCAGGCTGTTCGGTTTTTGCTGGGTGAC
GAACACAAGGATCTGAACGAGTGCTTTGAATTCATGGAGGAGATGGCTGCTCAGCAGTCGGTGCTCAAGGGACTCAATCTGAAGAGTCTGCACGAGTGTC
GTGCTGCATGCGCCGAGTTGATGAAGGCACTGCTCGAGGTGCCCAAAACGACATCGGACAACAGCATCAAGTTCCAGCGTGCGCTTTATCGCGTTATTGA
CTGCGTAGAGTCTGTGCTGAACTGCATGAAGAAGATCCTCGTGAAGCAGGAGAACCTGGTGCAGATCTTGACGGACACTCCGTTGAAGCAGAGCTCCTTC
TTTTTCCCGGGCGATGCCCAGCAGTACGCCAACATGCAGCTGCAACGCCTGGTGAACTCGGAGGCTGCCTTGGACATTGTGTCGCGAGCGTACCAGCTGC
TGACTGTGGATAACTTCGATGCGGAGCCACGCTCGGATGAAGGACGCCGTCGCTTGCGCTTCTTTGCCAACTCTCTCTTTATGGACATGCCTGAAGCAAA
GCCGATTCGCAAGATCCGCTCGCTGACGGTGTCGACTCCGTACTACAACGAAATCGTGATGTACTCGATCAAGGACTTGACGGCTCAAAACGACGATAGT
ATCAAGCTGATTTACTACCTGAAGACCATCTATCCGTTCGAGTGGGAAAACCTGCTTGAAAGGCTTCAGGCCAAAGATATGGAAGAGGCTCTGAAGAAAT
ACCCCGAGGAGGTTCAGCTGTGGGCTAGTTACCGTGGTCAGACGCTGGCGCGTACCGTGCGCGGTATGATGTACAACGAAGACGCCATTCGGTTCCTGCA
CTGGTTGGAGATCTGTGAAAACGAGGTGATGCACCAGCCTGGTTGCCCGTGCAACAAGTGCAAACGCCTAAATGAAATGGTTGCGCTCAAGTTCAACTAC
GTGTGCACGTGCCAGATCTACGGTAAGCAAAAGGATGAACAGCGACAGCAGGCTGCTGACCTGGAGTACCTGCTTCGCAAGCACCCAACCCTTCGTGTTG
CATACGTGGACGGCCCCAAAAAGATGAAGGAAGGCCCTCCGAAGTTCTTCTCCGTCTTGGTGCGTGCTGACGGTGAAAACATTGCCGAGGTCTACCGTGT
GGAGTTGCCGGGTAACCCTGTCATTGGTGAAGGTAAGCCTGAAAATCAGAACCACGCCATTATTTTCTCGCGCGGTGAGCTGCTCCAGTGTATCGATATG
AACCAAGACGGCTACCTCGAGGAAGCCCTGAAGATGCCGAACCTGCTGTCAACCAAGGACTCCGAAACGAAGAAGTGCCCCTTGACGATCATCGGTTTCC
GTGAGCACGTGTTTACGGGCGGTGTGTCGAACTTGGCCAGCTTCATGTCGATCCAGGAACTGTCGTTTGTGTCTCTGGGTCAGCGTATGCTGGCG