Description :
From Genome Similarity Track
Location :
Scaffold_30:108479- 122391
Transcript NameFunction/comments
Physo_156837hypothetical protein
Physo_134121ATGSL10 (GLUCAN SYNTHASE-LIKE 10); 1,3-beta-glucan synthase
Physo_134122ATGSL10 (GLUCAN SYNTHASE-LIKE 10); 1,3-beta-glucan synthase

Sequence
13912 bases(100 bases per row)
TCAAGCGCAAGTATGGCTACCACAGCAGCGGAACTTGAGCTACCCCGGTCGTGACTACTGTAGACACCACGAGGGGTATCAAAGTTACAAGGCCTGACAG
TCCGTGATCGTCGCTCCAGCTGAGGCTCGCGGATCACTTTTGACGCGCACAATATTTTATGCACCAGTGTAGTACTTAGTAGTAATAGGATGTTTCTCGC
GACCACAGCGACTATTTTGTGGTTGCTTCAATGTCGCTCTGTATTCTATGATGCAAGCAATCTTCGGAAATTGCAATATTGCCTTACACTCTCATTCCAA
TTCGATCCCGAAAAGTGTACGCAGATGCCACTGCTACGACGCCTATCGCCACGGCCGAGACGATGAAAGAAGCCTGTAATGTAGCAAGACAGAGCACGCC
CATTGAGTTGGGTAAGAATGCAACCTACGGACACTTGATACGCAGGTAGCGGCTTACCTGCCAGGAACCCAGTACATAGCTCGATTTGTCGCCATCCCTA
TTCATGATTATGATGGCACGGTGGTTAATACTTCGAAGTAAGAGCACACGCCCCACCATGCTGGGACTAACCTTTCTTGTCGAGGAGGCAGCGGCGGAAC
CTCTTTTAGCATTGGAGCGGTCGCGCTGGGCCACGGCTGGTGCCCGAAAGGGAACTGAAAATACGTGTTGGCTCTGCAATTTTGGGAACGATAAAGGTTA
GGCAACTGGAATTTGACAATGGAGAATTAGATATGCGTACTTTGAGGCTGATTCAAGTTGAGCCCGCTGAAGAAGCTGTGGCGGCGGCAGTTGGTGAAAA
AGTACAACAGCCCGCGCGATGACTTTTTCAACATCCATGGCGAGGGGCAGGCTCGAGAGCAACCCGTGCATCGTGCCGAAGTCACGTTCGCAGCGAAGAA
TCTTGTCCTTTGCCTCAAGTAGAACCTGCATATCGGTCATTTGCAATCCGTCAGATGCAAATTTGTTTGCAGAACTGTCAAACCAATTCGGAGACGAGGG
ATGACCACCTACAGCAGCGGATACATATAAGCTGAAGAGCGGATGGGAGACAAGAAACACGTCGTACAGCCGCGCAACATCCTGGAATCGCCTCAATTGA
TGCGCAAACCACGTGATCATCCACGGCAGAGCGAAATACGGTTCAACCTGAGCCAGACACGCAAAGTTTGTCAGCTTGGCTCCGCGATAATAGTTGATGT
GCACCAGAACTCACCCCCGACTCGTGCAGATGCTGGTAAAGCAGCTCGTCAGCCGCATCCAGCAGCGGAAACAATAACCTGGTCGTCGCCATGACTTGCT
CGAATCCCGACCGCATCGGTTCACGCTGGTACGTCTCGCTCACAGTTCGCACCGCTTGCAGCGTTCCCTTCGAGTTGCCCAGTGTCAAGAGGAACACCGA
AACGATATCGTGATACCCCTGGAAGTAAAAGAGCTCGTCATTGGCGCCCAGCACCCCCAGAATAATGTGCGTGAGCGCCCGGCGCTTGACGCGGCGCTCG
CTCTCTTTAAGCCCTTGCAGCACGTCATAGTGCCACAAGGATCGCTCCACGTCCTTCTCCACCTGCGCAGCGTCCCGATGAGCCTGATGGGACTGGTTCC
CGGTGTTCGAGGAGCCGTTCAGCGCTGCCGCATTGACACCCAGCAGGAAGGGCCACAGGTCTCTGCGGAACTCTTCTGAAACCAGGCCTTTCGATGCTAC
TGCGAGCCGGCGCACTTCGCGGAAGCAGGCGTCGCGCTCTTCCGCGGCGGCGGCGTCTCCGCGGTCCAGAGCGCGCAGGCGAAGAATGACCGCGCGCAGC
TCCTTCTCCTTGTGGCGGATGAGGCGGCGCTCGCGCTCGGCCGGCGCCCGACCGGGGATGCCCCGCTCGCGGTTCGCGCTGCGCTTCTTGGACATGGGGT
CGAAGATACTTCACGCCTGCAACGAGCGTACCACATCATTTTTGTATTTTTGAGAAATGTATTTTCAGAAATTTCAAAATGGTCCAATCGCGATCGTGCT
GATCTTTGATGTGGCGCGAACACAAACCAGCTGGGGAAATTAATTGCTCGCGACGGATGCGTCTTGGATCCGTCCAGACAGCGCGGTGGGCGACGCTGAC
AGCGCTCGCCTCCTTCCTGCAGGGCGTCGAGACGTTTCCGCCCCACGTCTCAACGAGATCCACATTGCGCGCGGCGCACTCTTCAAAGCCTAGTTTTGGT
GCCAAACAACAGAATCCAGCTGGTCAACACTGATTCCTGACGACCGCTTTTTATAGAGGACCCTCGCAGTAATGTACAGGCAGCAATCCTTCCACTTCAC
CCATTCATTCACCCATTGCACCTTGGGTTGAATGGGAGACTGGGTGACTGGGTGGTGAAAAGATGGGTGAAAAAGAGTACCGTAGTCACTTTTAAAAGTA
CCGTAGTCATGACAAACACGTCTAAGTGCTCGTACGGATTCCGTGCCTAAGTGCGCATACGTCGGCTAGCCAATCGTAGCGTTCACGGTTTCGCCGCCGT
TCCAAGCCGATCCGCTTCGAAAAGTGCCGTTCCAGCGAACCCATGTCTGCGATACAAACGCCAAGTCAAACGATCCAAGCCTCAACCAGCGCGAAACCGG
GGTCGAAAGCGCGATCGACCAATGGGCGCGTCACCTTCATTGAACCAGCCAACTAGCGCGCAAACGCCGTTCCAGCCGCGCAGTACCGTGAGCAGTTACG
CGCAGTACCGTGAGCAGTTACGCGCAGGACGACCATCGCTTTAGAGAGGTTGTTTAAAACAGTTTGAGAGATCAAAAAGCCCAAATCGTACTTTTCCAGT
GGGTGCTTTGAAGCGCACTTACCAACACCCCTCGAATAGAGGCCCCCTCGAATAGAGGCTCAGGCTGACTCAGGCCTGCAAACCGCACTCGATATCGAAG
GTAAACTCTTTGTGACAGGCACCTAGACATAATGAGATCAAGTGTTTCCGCAAAGTCGGCAGGATGCGGTCTTGCAGGTGATAGTATGTCAGGATTCTGA
TTTCTACACCCAAGCACCACTTGGCTTCACTATTGGCCCGCCGCGTCCGTTGGTGTCGGTGTCGGCTCGCTCTCAGTGTGGGATATCGCGAGCCGACGGC
CAGAGGTTCGGAGGAAACACCCGAGCGGACGATCGCTGCCTCGCACGCCGCGCCCACATACAGAGCGCAAGTGTCCCCGCCAGTCGCGATCGGCGATAAG
ACCTGCCGCCAGCTGGGCAGTCGCACGTGGACCGAGACAGGGCCCCGAGTCTCACTCGCCTCGCCGCCCGCTGTCTCTCTCTCTCTGCTCCCGTCCTTCG
TCTCTCAGTCTTGAACGCCCCGCAGCCCGCGCGCGACCATGGCGCGTTCCGGCAGCGATGGCGACAGCGATGACGCCATGCAGTACAGCAAGCCGCTGCG
CCAGCAGAAGAAGCTCTGCGATGAGGCCATGGAGCTGGTCAACGCCGGCGTGGCCATGCAGAACGCGTCGCCGCCCGACACGGCCGGCGCGGACGCCAAG
CTCTCGCGCGCCGTGACGCTCATGGAGCAGGCGCTCGCCATCGAGTACCCGACGCAGGAGGAGCGCGACGCCAGTCAGCGCCTCAACAACAAGATGAACC
GCTACGTCAAGATGATCCGCAGCCAGCGCGAGAAGGGCGCGACCGGGGGAGCCCCGGGACGCGGTCACAACACCAAGTACAACATCCTGCCCATGGACAA
TCTGCCGTCCACGTACAACGTGATCCTCGAGCTGCTGACCAAGTGAGTTGCAGTGCGGTTTCACCCTTGTCTGATTCAGGGGAAAGACGAGCTGACGTTG
TATTTTTAATCTTGTGTGTGTCTACAGCTCGTCGACGGCCGGTGATATCTTCGAGAGCATGAAGACCACCTTCGGTTTCCAGGAAGCTAATGTGACCAAC
CAGAAGGAGCACGTGATGCTCATGCTGACGAACTTCAAGCTCCAGGAGGAGGAGCCGAACCAAAACGGCGACGAGCACCACCAGCTCGACCACCAGCAGG
AGCTTGACATGGCCAACAAGGGTATCAAGCGCCTCCACGAACGCATCTTTGCCAACTACACCAAGTGGTGCAAGTACGTTTCGACCAAGCCTGCGTTCAC
GAGCGACCCGCTCGTGGATCTCGTGCTGTTCTTCCTGATTTGGGGAGAGGCTGGTAACTTCCGCCAGACGCCCGAGTGCCTTTGCTTCCTGCTGCACACG
TCGCTTCCGCAGGCTTCGTCTCGTGGCGGCAGCAAGAATCCTGGCGACTTCCTTGCCGAGGTCATTCGCCCTATGTACAACGAGATCAAGAAGGATAACG
ACAAGAAGACAGCGCAGGGCGCCCGAGCTTCTCACGCGGAGATCCGTAACTACGATGACTTCAACGAGTTCTTCTGGAGCAAAAAGTGTCTGAAGTACAA
CCCGACGACCATCCACGAGGCATTTGGCGAAGTGGACAAGAAGGGTCGCCCGAAGGTCATCAAGAAGAGTTTCGTGGAGAAGCGCACGTGGTTCCGCGCG
CTGATGTCTTTCCGCCGTATCTTCTGCTTCAACTGTGCGCTATTCATGGCTGTTCTCGGATTCTCTATCAACGTGGTGATGTATTGCCCGGACACGCCAA
TTTTGTACGGCGCCGATCTGAGCAACGGAAACTCTCGTGGCTTCACCGTTTTCGGCAAGAATATGACGGCATCCGACTATACTGCTATCGGATCTGGCGA
TGGATCTGGTGATAAGTCGAGCTCGGGATCGGGAGCTAGCTGTAACCACCAGATGCTGGCGACTTGCCTGGGTATGACCTACACGGAGGGTATTTTCGAG
AATATTCCTATTGATTTCAAGGCACTGCTGCAGCTTGTGCCGTTCACCGACTGCGTGGAGAAATCTACGGGTCGCTGCGGCTGCTACTTGGATTTAATCG
ACAATTGCTTTTCGGAAACCGGTCAGACTACTCACGTCACCGAAGACGAGCTTACGTTTTCGTCATCGAGCGAGTACGACCAGAGCATGTGTGTTGTGAA
CTGGCGCGCTGCCGTTGAGTCCATCATTAAGGACCCGGGTCCGGGTAAGCTGAACTGCGAAATCTGCCAACTGGACATCAAGGCGTTGATCACCAACGGT
AAAATCGGTGATCTCATTGCTGGACTGTTATCTGTTGGAGACGGCACGCCCCTTTCCGATGGAGACATCACTAATACGAAACGGACGGATATGGGTGCGC
TTGCCATGTTTGGCGGTGTCGGTTGTCTTGGTCTCGTCTTTGCATGCGAGTTCTTGAACAAGATCTTCTCGCGTGTTGGATCAGGCTACGTCGGGCGTTC
GATGCCAGTTCCAATCCGCGCATACTGCCGGTACACGTGTTTTTGGCTTCTGCTTTTCATGTGCAAGCTGACCTTCGACTACCAGTACATGATGAAGGCC
CTGGTGGAAACAACGTTGTTCATTTGGTACGCGAACGAAGACGAGTACCTCAAGTACTCGAACTTCATTCTCCAGGTCACGTTCCACAACATCATCTACA
TCCTGTTCTTGTGGATTCCGGCGTTCTTCGTGTTCATGTACGACGCGCAGATCTTCTACTCTGTGCTGTCGGTGATCTTCGGTTCGTTTGCGGGTTTCAA
CCTTCGCATCGGTGAGCTGCGCTCTTTCCGTGTTCTTCGACTTTCGTTCAAGTCCATTCCCCGCATGTTCAACAAGAAGATTGTCCCCAACATTCAGGAT
GGAGCTGCCGATGGCAAGAAGAAGAAGAAGAAAAAGAAAAAGGGTGAGAAGGAAGAGTCAACAATGCCCGTGCGTCACTTCGAGCGTGTGTCAATGGCTG
ACGGAATCAAGCCTCTTACGGTGAAAGCTCAAATGTACTCCAACCTTCTGGATCAACATGGAGAAATGTACAACGAAGTCAAGACGCCCAATGACAAGGA
TGACGCAAGCTCTAGCGGCCGTCAGTCTCAATTGGGTTCAGTAACCGGTGTCTCTGGCGCCGACTTCGAGCGTACTATTCCTTTTGCGATGGCCTGGAAC
CGTTGCCTCGGCAGTTTGCGCGAAGCTGACGTTATCAGCGACCGCGAGCTGAACGTGCTGAGCTACTTGATCGACTCAAAGGACGCAGAAGACCGCAAGT
TGTACCCGCCTGCTTTCTTGACGGCCGGCAAGCTGGACGAGTCTCTTGATATCATTGTTGATTGCTCAGCTGTGTACGAGAAGCTGAGTTCCGACAAGAA
GAAAAAAGAAAAGGCGCTGCAGAAGATTGAAAACACGATGCGCGAGCGTCTGACCAAGGACGATTTGCGTGTGGAGTCGATTCTCGGATCGTACAAGTTC
ACTTCGCAGGCTGTTCGGTTTTTGCTGGGTGACGAACACAAGGATCTGAACGAGTGCTTTGAATTCATGGAGGAGATGGCTGCTCAGCAGTCGGTGCTCA
AGGGACTCAATCTGAAGAGTCTGCACGAGTGTCGTGCTGCATGCGCCGAGTTGATGAAGGCACTGCTCGAGGTGCCCAAAACGACATCGGACAACAGCAT
CAAGTTCCAGCGTGCGCTTTATCGCGTTATTGACTGCGTAGAGTCTGTGCTGAACTGCATGAAGAAGATCCTCGTGAAGCAGGAGAACCTGGTGCAGATC
TTGACGGACACTCCGTTGAAGCAGAGCTCCTTCTTTTTCCCGGGCGATGCCCAGCAGTACGCCAACATGCAGCTGCAACGCCTGGTGAACTCGGAGGCTG
CCTTGGACATTGTGTCGCGAGCGTACCAGCTGCTGACTGTGGATAACTTCGATGCGGAGCCACGCTCGGATGAAGGACGCCGTCGCTTGCGCTTCTTTGC
CAACTCTCTCTTTATGGACATGCCTGAAGCAAAGCCGATTCGCAAGATCCGCTCGCTGACGGTGTCGACTCCGTACTACAACGAAATCGTGATGTACTCG
ATCAAGGACTTGACGGCTCAAAACGACGATAGTATCAAGCTGATTTACTACCTGAAGACCATCTATCCGTTCGAGTGGGAAAACCTGCTTGAAAGGCTTC
AGGCCAAAGATATGGAAGAGGCTCTGAAGAAATACCCCGAGGAGGTTCAGCTGTGGGCTAGTTACCGTGGTCAGACGCTGGCGCGTACCGTGCGCGGTAT
GATGTACAACGAAGACGCCATTCGGTTCCTGCACTGGTTGGAGATCTGTGAAAACGAGGTGATGCACCAGCCTGGTTGCCCGTGCAACAAGTGCAAACGC
CTAAATGAAATGGTTGCGCTCAAGTTCAACTACGTGTGCACGTGCCAGATCTACGGTAAGCAAAAGGATGAACAGCGACAGCAGGCTGCTGACCTGGAGT
ACCTGCTTCGCAAGCACCCAACCCTTCGTGTTGCATACGTGGACGGCCCCAAAAAGATGAAGGAAGGCCCTCCGAAGTTCTTCTCCGTCTTGGTGCGTGC
TGACGGTGAAAACATTGCCGAGGTCTACCGTGTGGAGTTGCCGGGTAACCCTGTCATTGGTGAAGGTAAGCCTGAAAATCAGAACCACGCCATTATTTTC
TCGCGCGGTGAGCTGCTCCAGTGTATCGATATGAACCAAGACGGCTACCTCGAGGAAGCCCTGAAGATGCCGAACCTGCTGTCAACCAAGGACTCCGAAA
CGAAGAAGTGCCCCTTGACGATCATCGGTTTCCGTGAGCACGTGTTTACGGGCGGTGTGTCGAACTTGGCCAGCTTCATGTCGATCCAGGAACTGTCGTT
TGTGTCTCTGGGTCAGCGTATGCTGGCGTTGAACCACGTGCGTCAGCACTATGGTCACCCCGATATTTTCGACAAGCTGTTTGCTATGGGCTGCGGTGGC
ACTGCTAAGGCGTCCAAGGGTGTCAACCTTTCGGAAGATATTTTCGCTGGTTTCAACAGTACCCTTCGCGGTGGCCGCGTCTCACACGAGGAGTTCATAC
AGGTGGGCAAGGGTCGTGATGTGGGTATGCAGCAGTTGACTCTTTTCGAGGCCAAGCTGTCGTCTGGTGCTGGCGAGTGTGTCATCTCGCGCGATGCCAT
GCGCATGGCTTCTCGTCTGGATTTCTTCCGCCTGCACTCGTGGTTCTACGGTAACTTGGGTTGGTACTTCACGCAGACTATGACGGTGGTGGGTGTGTAC
TTCTTCATCTACGGCAAGGTGTACATGGCTCTGAGTGGCATGGACAGCTACTTCCTCGAAAAGGGTGGCCTGGGCATCGGTGGTACACTTAACACCTCGT
GGGCGTTCCAGTTCGGTTTCTTGCTGGTGGTGCCTGTTGTCGCCGTGGTTGGTGTGGAACAGGGTTTCCGTCACGGTCTCACATATTTGATTTGGAACAT
CTTGACGCTCGGCCCGTTGTTCTTCACATTCCAAATGGGCACGCGTATGCACTACTTCGACCGCACGTTGATTCACGGTGGTGCCAAGTACCGCGCTACG
GGTCGTGGTTTCACAATCAAGCACGAGCGTTTTGCCGAGCTTTACCGCTTCTACGCATTTAGCCACTTCTACCGCGCCGTGGAGCTTGTGTTCTTGTTGA
TCCTGTTCCGTGCGTATGGTACGTTCTCGTGGTGCAATTGCTCGTGGACGCAGGACGCTCAGTTCTACAACTACTACAAGCCTTCTGACAACGACTGGAA
CACTCGTTGTTACGCAAACTACTACCAAACGTGCGTGGAGCCGACGAACCAGAACTACGGTGTGATGTCGTACTCGCTGTGGATTATCGCGGCGACCTGG
TTGTGGGCCCCGTTCTTCTTCAACCCGAGCGGCTTCGACTGGGACAAATTGATCGAGGACTACAGCGACTGGCAGAACTGGCTGAAGACGACGAACGATT
CCGCGGCCAGTTGGTCGGGTTGGTGGTCCAACGAAGTGGAGTACCTGGAGCACTCGACTAGGGGCTCTCGCATCGTGTCGATGATCCGCAAAATGCGTTT
CTTCTTCGTGGCCTACGGCATGTACCTCCAGTTGGCGTACAAGACGTACTACGAGGACCAGGACCTTGAGATCGAGAAGGGATCCATGATCTCCTACGCC
TTGTCCGGCCTCATGTTCATCTTGGTGTTGCTTCTGCTGTGCTGTGGCTACATCGCTAGCCGTGTCAAGAAGAAAATGACCTTCAAGCAGAAAAAGCTGC
GCAAGATGAAGTTCGTGCTGTCCTGCTGCGGTCTGCTGGTGGCATGCGTGAGTCTACTGGTCATCTCGATCATCAACTTGATCGAGATCGCGGTGATCAT
CCTTATCGCCGCGTACTGGTTCCTGCAGCTCTGCGTTTACCGCAACCAGACCAGCCATGTCGTGGTGCGCGCGATGGCGCGCTCGTACGACCGGTGGGTG
GGCTGGATCATCTTTGGTCCCGTGCTCTTCATCGCCATGTTCCTGCCCTTCCTCGCGTCCTTCCAGCAGCGCGTCATGTTCAACAACGCGTTCACGTCTG
GTCTCGAGGTGTCGAAGCTCTTCGCGAACGAGGCGGCGTCGTCCACGAGCAAGATCGTCAAGGTCAAGCGCGTGGCCAAGAAGAAGAAACGGAGTGACTA
GAGCTAGCAAATCGTATCGTCCGGATCTGCTGCGCCTGCTGGGTAAGGCGTGCCTCACCTGGATCGTGCTGGAGCGTGGCTTGGAGTGCATCCTCGCGCA
CCTTGGACCATTCCCCTGCTTTCCTGGCGCGCACGCCACGGATGGCTAGCGCCCACTCGGCACTCTTTTCCTTTCAGTGTCCTCTTTTTTTTCGTGTACA
TCGGTAAGCACATAGCTAAAATACACAAGCCAGAGATGGCGATGAACATGCATCGGAGCGGCCCTATCGTTATTTTGAGGTCGTGAAACGCGCAGCTAAA
GGACAGGCATGGTCGCAAGACGAGCAAATGATCTGGCTGGCAGTCCATCCTCGCTCGTCTCGCAGCTATCACCCTTCTGCTACCCATTGGCTTGTCATTT
GGACAAGGACAGCTATCATGTTGGCACGGGTGCGCGCTGTTCGCTAGAAGACCTTACGATGCGATCTGGCGGGCCGCATTACATTGGCAGGCAGGTCGGA
AGTTCACCATTACTGTACCATTGCTGTTGCCGCTTCGGAAAGTTCAGATACTGAAATAGAAACGCCAAAAGTGCACCCGTTAATATTGGGACTCCAAAAA
AACACTGCACATTCAAGTGTATGAATACAGTAGCTGGCGGAACAGCTCCAACGGCGCCGTGCCAGCACGGCACCTTTGACTCACGTGTGACCATGTCGAC
CAGACTCTCACTTTGGATCAAACTCTTAGTTGGGGACTGTGTGTCTAATAATTTATACCAAGCAAAAACTGCAGCTGCTGGTACTTTGCAACGATACAGA
AGCGTCGTACAACACTCCGAGGATGATATATTCTAAACCTCAAAAACTAACGATGCCCCTTCAGCACAATGGACGGGTTCGCCACCAAAAAGCGGCAAAT
TTGTGAATTGCAACCCTCTACTAGATAAACCGCTCTTCCGTGGGGCCTCTGTGATTTTGACGAACGATAATAGTGAATTGAGTTCCCCTGGCTGATAGAG
TAGGTATCGTGCGAATAGAGAGCACTCGCGAAAGTTCTGAAACAATTTTTTTCAACACCTTTATTAGCGTATTGTGGAATTCAATATTGCAGCCTGCAAG
ATAATTCCTGGTATCGTTTGCTGTTCTCAATGTGCTGTGGTAACACGATAAGGTTATCGTTTGCTGATACTAAATTCAGCACAGAATGAACTCGTGGGAA
CAATTCCCAAGACTGGCAATTGTAGGTGACATCCCTAGCAGCTAGCGTGTACGCTTCTCCTACTTGAAGAAAAGGTCAATGGACCTTTCGTTTACGGCGC
AGTATCTGCTCAACGCTGCTCAACGTTGACACTCATTAGTAGGAGTGCTAAAGTGCACCATCTGAGCTCAATTCTGTATTATACGATAAGCTAACAGGTG
CAAGTGTGCCCACGTAAGATACAGCTCAAAATAACGCCTAAAGGTTAAATTCCACCCTAAGATTATGCCAGTCGCTTGTCTCAGCTCGGCCCTTTTTCAT
TGAGCTCGACTGAGCGGCAAAATGTGGCTTTGGCTTTGATCGGACCATTTTTCGAGCAGTTGTGTCAATCCGGCAAAAAATCGCTCGTGCCGTCGTCCAT
CAAATGTGCACGATGCTTATCAAAGCTGAGCTCGCCGCTGCGTGGTGCTGCTTCTGGAGGCTGAGGAGCCGCGGGCTCGCCACGCTCACGGGCCCCGCCC
GCTCCAGAGGGTGCCTGGTCGTATGGCCGGCGTGCGCGCAGACCACATGCTCAGCCGTTTTCTCAGCAGCTCCAGCCTACACTTTGCGTAACGGATGACG
GCCGCCGCACCGAGGCGCCTTTCACAGCCTCAGAAGCGTCGATGTCAAGCCGCACTCAATGCCAGCACAGCTGGCGGTGGCGTACCATCTTTCGCGGCGC
GAGTTGGGGCTCCAGTGTCTGGTCTCTGAAGTTTAGGAGCAGCCTTGAATTGCGTACTAAACAATAGTACATATGCGACAAAATAGTATTTTGCCATCGA
TAATTACTATTTCATTCTGTTGACAAAAATACTACTAGTACATGCTTGTAAGGAGCAAGCAACACTCATCTGAGTAAGCAGGTATTTGTTGCGGCCTTGG
CTGCGGGCAGGACGAAGACTGCTACAAATAAGCCTGGGTCGTGGATGTGCAGGTACGAGAGGAGCATGCACTTCGCAGTCCACATTGTACCGTTAGGCCA
CTGTTCCACGCTTTCTAGTATCAGCTTACACACGTCGAGCGTATCTGATTCGTTTAGTTGTGGGAGGACTTTCAGCGGTAGATCCCAAATATCTCGACGC
GCGATAGAACATGCTTCTATCGCTAATGAGGTCGCTTGGGGATCTAGTTTGTGTCCTTTCGTCCTATACCAACGAGTTCCTGGATACAGTAGCCTCGGCA
ACCGAATCTACTCGGGAGAGGACTCGCTGGAGACACTTGTGACGCACATGAACACTGAAGCATCGCTCAATTGTTTTCCTTGTACAAGTTGTCAGCTTTT
TATCTTCGGAATGCGCAATGCGCCTTGAGTCCATTATCACACGAGTTCTAGCGTTGCAGGCCGCACGATCGTCGGGACAGATCGCATTGTACTGCGAAAA
AGTCAAACGAGGCGATCCCTTCGCTCCAGGCAGGCAACACGTCGACCACAATGCGCCAACCACTGGCCTTTGTAATGGGTGTGAAAGTCGACGTTCCAAG
CAATAGTACTCCGACCAGTAGTAGTACTACCTTTTGCACGCCGTCGAAAACCAAATGCTTGGGTAGTACAACTCGCAATTTTCTAAATAAGCTTTTCACT
GGTAATTTTTATATATACTGTAGAAACACATACCTTATCGAGAGGTCTAATATGGCATTTTGTATGGTGTACGAACAGAAGCGATACGCTTCCCGGTCGT
TAGGTCGCCAGTTCGGCTCGCAGCGTCTGCGCGCGGCTGCTCTCCTGCTATCGACGTGTAGGGGTCTCGGTCCCTCCTGGCGCGGATCCGAAACCTCTGC
CTTGACTTGGCTTCAGTATAGCGGCGCTGGCTCCAAGCCGTTTCCGCGCGCACGCGCTGCCCTCTCCGCGGAAAGACGTCGGCGAAAACATCCAGCCAGC
GAGCCCCAAGCCATTCCCCCGCTTTCCATTCCCCATTCATTTGAGCGCGGGCGATTGCTTTGCTCTGCTCTGCGGTCGGTTGCTCTCTAACCAGAAGGAG
CAGAGGACGCGCGCGGCGAGCGTACGTACTTAACTACAGTAGGGGACTCGGGTCGGAGCCATGAACCGCCGCGGCCACGGCAACCCGAACGGCAATGGCA
GCGAGCGCGAGGGCAGCTCCGTGGGCATCATGACGGAGGCCCTGGAGATGCAGCGCCAGATGTGCGACGAGGCCATGAGCCTCGTGAACGCCGGCGTGGC
CATGCAGAACGCATCGCCCCCCAACGTGGCCGAGGCCGAGCGCAAGCTCACGCGCGCCGTGGACATCATGGAGCAGGCGCTGAGCATCCGCTACCGCTCG
GCGGACGAGAAGGACGCGGCCGACCGCCTCAACAACAAGATGATGCGCTACGTCAAGATGATCAAGAGCCAGCGCGCCAAGAGCGTGGGCGGCGGCGGCC
CCAAGGGGCGCAACCTCGTCAAGCACAACATCCTCGAGATGGAGCGCCTGCCCGAGGTCTACACGCCCGTGCTGCAGCTGCTCAACAAGTACGTGTCCCT
GCCCTCCTCCTCTCTCATTCATTGCGAGGGGCTTAACTGCCGCCACCTCCGGCAACGCCGCGTCGCAGTTACAACCCATGCTTAAACTAACTGCCTGTAT
CTGTGTGTATCTATCTAACCAGCTCGAACCAGTTGGGAGACATCTGCGAGACGCTGAAGCGCACGTTCGGCTTCCAGGAGAGCAGCGTGCTCAACCAGAA
GGAGCACTTGCTGCTGCTGCTCACCAACTTCAAGGAGCAGAGCGGCCAGGACGACGGCAAGAAGAAGAAGAAGAAGCAGGACGAGATCGAGGCTATCGAC
GACTACTTGCGCCAGCGCGACCCGCAGCTGGAGATGGACCTGGCCAACAAGGGCATCACGCGTCTCCACAGCCGGATCTTTGCCAACTACAAGAAGTGGT
GCAAGTACGTCTCGCAGAAGCCCAAGTTCTCCAGCGACCCGCTCGTGGATGTGGTGCTCTTCTTCCTCATCTGGGGCGAGGCGGCCAACTTCCGTCAGAT
GCCCGAGTGCCTGTGCTTCCTGCTGCACACGATGCTGCCTAAGGTCAACAGCGGCGGCAACGAGGAGCCCGGCACGTTCCTGGCTAACACGATCCGCCCC
ATGTACGCGGAGCTGCGTCGGGACAGCGACAAGAAGACGAGCAAGGGCGCCACCGCCCCGCACAAGGACATTCGTAACTACGACGACTTTAACGAGTTCT
TCTGGACCAAGA