Description :
From Genome Similarity Track
Location :
scaffold_2:1084097- 1090048
Transcript NameFunction/comments
Plaha_PHALS_06741hypothetical protein F443_16459
Plaha_PHALS_06742hypothetical protein
Plaha_PHALS_06743obg family gtpase

Sequence
5951 bases(100 bases per row)
ATGGACCAAGGAGCTTCAGGCGACTTTCGGTTGGTCCATTTAAACGACGCGCATCGCAACAGCGAAGCCGGTTACTGCAGTAATTTCATTGTTACGTCAA
AGTACACTATTGTCAGCTTTCTGCCTAAGTTTCTCTTCGAAAGTTTTCGTAAACTTTCCAACCTTTATTTTCTTGTTATCTGCATCTTACAGTGTATCCC
AGAGATAAGTAACACAAATGGTAATCCCTCGACATTACCCCCACTAGTCTTCATCATAGCGGTTGATGGTGTCTTTGCGATTCTTGAAGATCACAAACGC
CATCAGGCCGACGATAGTGCCAATGCTAGTCCAACTCTCGTGCTGGATCGTGAATCCAGACAATTTAAATCATCTCCGTGGGCTGACGTCGTAGTGGGAG
ATATCGTCAAAATTTCGAATCGTGGACTCGTACCAGCTGATATACTTGTACTTGCTGTGAGTGAAACTCCAAATCAACCACCTTGCGGTATTTGCTATGT
TGAAACCAAGTCTTTAGATGGAGAAACGAATATGAAGGTTCGATCCGCCATGGAGCGCACTTTAACAGACATGGGTTCAATCGACAATTTGGCCAAAATG
AAAGGTGTCGTTCGGTGTGAACACCCGAACAATGCAATCAATTCCTTTCAAGGTGTGCTTGAGCTTGTTGGAAAAGATAATGCCGCGATTCCGTACGAAA
GTATCATCTTACGTGGGTGTATCATTCGCAACACTGACTGGGTACATGGTGTTGTTTTAAATACTGGTAAAGACACAAAGATTATGATGAGTAATTCAGC
CCCTCCATCTAAGATGAGTTCCATGGACCGATCCATCAACCAGTACACGATCGTGTTGCTATTCATTCTGGTTATTTTCAGCGCTGTTGGTGCGACAGGA
GCAGTGAGTTGGAAGGCCAAAAACAAGTCTGTGTGGTATCTTGCGTTGACTGCGTCTGAAAACGGAGTTGTGTTGGACTGGCTCATCATGTTGTTCTACT
ATCTACTACTCATGTACCAGTTTGTTCCCATTTCGCTAGCTGTCTCTATGAGTATGGTCAAGTATCTTCAAGCGCAATTTATTCAATATGACATCAACAT
TTATCATCCTGACACAGACACGCCGACTCTTGTGCGTTCAATGGCGCTTAACGAGGAACTTGGGCAGATCTCTTACATTTTCTCGGATAAAACTGGCACT
CTGACATGCAATGTGATGGAATTTCGAAAGTGTTCGATTGGTGGTGTCTCGTACGGCAACGGCACTACTGAAATCGGATTAGCAGCGCTCCGGCGTGCCG
GAAAACCTCTCCCAAATCTAACTACACAATTAAAGGGGCCGAAAGTTCCTTATGTAAATTTTGATGGTCCAGAGTTGTTTGACGATATGAAGGGGAAGTC
GGGATCAATTCAGCAAGGACGCATTGATGCCTTTTTTACACACCTTGCCGTGTGTCATACTGTCATTCCGGAACGTCACGAGAATTCGCCACACGTTACA
CTATCGGCTTCATCTCCTGATGAGCAGGCACTTGTTGCAGGTGCAGGATTCTTTGGGTATGAATTTGTGAATCGATCTCCTGGAATTGCTCACGTAAACG
TTCGCGGAGTGAACCAGAAGTACGAAATTTTGGACGTGCTTGAATTTAATAGCACAAGAAAGCGCATGAGCACAATCATTCGTCATCCAAACGGTAAGGT
TTTTTTGTACTCGAAAGGTGCCGATGTGATCATATATGGGTTACTTGCAAACGATAAGGCGACGGACACAAGTTTATCTCTTTTACAAGAGATAACCCGC
CGCCACATTAATCAGTACGCGGAAGATGGACTTCGTACGCTCACGATCGCAGTTCGAGAAGTTGTGCCTTCCTATTATGCTGAATGGGCTACACGTTTTC
ATGATGCCCAGAATAATTTAGATGAAATTGACAAACGCAAAAAAGATCTTCCGAACGAAATTGATGCTTGCATGAATGAGATTGAGTGCGACCTTGAACT
GCTCGGAGCAACAGCGATTGAAGATAAACTGCAATCAGGTGTTCCAGACACAGTCGGAAATTTAGCTCGTGCGGGAATCAAGATCTGGGTACTCACAGGC
GATAAAGAGGAGACTGCCATCAACATTGGTTTTGCTTGTCAGCTTGTTGTAAACGAAATGAAGCTTTTTATCATCAATGCAAAAAATGCTCCAACCTCTG
AAGGACTCGAAAATCTTCTAAGGGAAGAGATATTTATTCGCAATGCTGACGTCACGGCATACCTTGCTTCACCACCAAGTACTAGAGGTGAACTGCGCGA
GTTGGCTCTTGTTATTGATGGTGAAACACTCATGTTTGCCCTTCGTGGACCTTGTCGTGCACTTTTGGCTGAATTTTCTCAGTATTGTAAAGCCGTGATT
GCTTGCAGAGTTTCACCGgctcaaaaagctgaaaTGGTCGCTTTGATCAAAGAATTTGTTCCTGGTGTTCGAACCCTAGCGATTGGAGATGGGGCAAACG
ACGTTTCGATGATCCAAGAAGCTCACATTGGAGTGGGTATTTCAGGTCAGGAAGGTATGCAGGCGGTGAATTCGAGCGACTACGCTATTGCACAGTTTCG
CTATTTGCAGCGATTGTTACTCGTGCACGGTCGTTGGAATTACCGGCGTATGGCGCAGTTGGTACTTTACATTTTCTATAAAAATATTCTCTTTACCGCT
GCTCAGTACTGGTACACTCTCCTGTGTGGCTTTTCTGGCCAAAAGTTCTTTTTAGAAAGCGGCTCTCAGTTGTACAACATTGCATTTACAGCTATTCCCA
TTGTCGCAGCTTCAATATTGGACCAAGATGTTAGTGATGAAGTCGCTATCACTTATCCCAAACTTTATCTCACGGGGCCTCGCGATGAAGACATCAACAC
CCACTCTTTCTCGCTTTGGGTCTTAGGTGCAATTCTAGAAAGCCTCATCATAACATTCATCACAATTTACAGCTTTCAAAGCGCGGGGTATGCTGGATCA
AGTCCAACAATGTGGCTGGAGGGGTTTATGGTCTTTACTCTTGTCGTGTCCGTCGCTAACGTCAAGCTCATCATGTATCAAAATAGTTTCCACTTTCTTA
ATTGTATCCTATACATTGGGTCATTGCTGGCCTGGCTCCTTATCGCCTTGATCTGTAGTCACGTCTATTTTCTCTCGGATCTCACGTGGGAGTTAATGCT
AGACCAAGCCTTTGGGCTCTCGGCTTTTTGGCTGATTTTCATGCTAGCTCCCGTGGCTACGCTCCTGTACACTCATTTACTGAACAGTATTCAGTCTACA
TACTTTCCAGAGTACTGGCAACTCGCAAAGGAGGTTATGAAGTTTAAGCTTGATTGCAAGCTCTTGGAATGGAATGACAATAGTGATGCGTCAGTGGCGA
CACCAGCTCGACTTCCTTGTGCAAAAAATCCCGCAGTTAAAAATGGTTCTGTGCTTCCAACGAGTAGTCGACCCAAGCCACAACATAGGACGACGATGCA
CAGAGGATATCATGGTTTTGCTTTCTCGAAAGATGGTTACGCTGGAGCTGCTGAGACACGATTGCTCATGAACCGGAACTCTATCGTTGGTTCAGTTAAG
TAAGTGATGTTACCTCTACCAAAATTATGAAAACATGTCCTACTTTGTTCAATCTCCGAGGTGCAGCAGGCACTACGTTTCCTCTTCCAGCATATCCAAT
TCGAGACAAAAGTCTTGAGTATGGAGGAGAGAAAAAGAGCAGCTCATCGATCGCACGATGCCTTCCCTCTATCGTCGTAGCTGTTTGGGATTCAAAAACA
TCACTTCGCCGAAGGAATAGCCTAACATATAGGGTATAGCACCCATCGGCATCACGTCAGCCAAGTTGGCTGGTGCAGCGATAATGATAATATACCTGGC
TGCGATTCTCTCTAGTCGTATCCGTCGGTCCATTTTCGAATATAGTGCTTCCTGTCGTCTAGTACGTCGTCTTTTAGTCTTTTGATACCTTTTCAGAAAC
AGACGTTCACTCTTCTCAGTAGCGTCAATTAGAACTAACGCAAGGTGGTGGGGGCTACAATCTATCCTTTGCGCAGCGCCACGCAGATTTCTGGCAAGAT
GAAGATTTTTCATTCTACAGGCCActtctgcgtcgtgctcttgctgctgctgacgTCTGATCTTTTCAAATTCATGAGCTACTACGGAAGCTTTGTGCTG
CGTTTCAGCCTCGGGATGTGCACGTGTAGATACCTTATGGATCGCTCGCTTGGCTTGCCTTTGTATGCTTGTTCGCTGCACCACCAGCCGCTCATACAAA
CGGTTAAAGTCGTCGCCATTTCTCCCTGCCATTCCTAAATTTTGATTTAAAAATGCCATTATGTTTTACATCGACAAACACTGGCCAAACCATGTTTTGT
CTATCGAAGCTGCTTAATGGATTGACTGTTGCGCCATTGCGTCCGCGGTCGCTTAAAAGCCTCCCATCAATGCGTGCGTTAAGTGTACAAAAACAcggag
atgatgatgatgtggagcTCGAAGTGGACGATCAAGAGTTACACTGGAATGATCTGGACAAactgaacgaaaatgtgAGCTATAATGTGGAGGAGCACGT
GAAGCAAAAGGTACGCATACGTCGCGCACAGCACTCGAAGCGCCGCTTTGTCGACCGCATTCGCATCAAGGCCACAGGTGGTCACGGTGGCAACGGTTGT
GCGAGCTTTGTTGCCGAGTCAACGACGCGTAAGCGTCCTAATGGAGGACACGGCGGTGCAGGAGGTGACGTGATAATTGAAGCCAACGATAAAGTGCAGA
ATTTAGCAAATGCTACTCATCATTTTAAAGGTGAATCAGGCACCAACGGCATGCGTACGTCCTGCAATAAATCTGATAATTTAATTGAGCGCAGTGCTGA
CTGTTGTATTCGTCCCTTTGCTGCAGCAAACGATTCTGCTGGAAAGAGAGGCAAGTATTGTTACGTTAAGGTTCCATGTGGCACACTCGTTAAGCGTGTC
GAACGTTACGAGCGTGAAATGGATACTGGCGAGTATGAGGTTGTGGACAGAATGGAGGTTGTGGCTGACCTGGACAAACCAGGTACAACTTTTTTGGCTG
CAAAAGGGGGTAAACCTGGACTAGGTAACCGCATTTTGGCTGGCAAGACGACCAAATCTGGACGACTACGCAAACTAATGCCTGAAAACAAGACGAGAGG
GTCGCCTGGTACATCGCAGTATTACGAGCTGGAGCTCAAAACCATTGCTGATGTTGGACTTGTGGGATATCCTAATGCTGGCAAATCTACCTTGCTCAGT
GTGCTGAGTCGTGCTACTCCTGCGATTGCACCATACCCTTTTACCACACTTCATCCGTACGTGGGCATTGTGGAGTTTCCAGACACATATCGGCTGAGTG
TGGCGGACATTCCAGGACTGATTGATGGTGCGCACCGCAATGTCGGTCTAGGACACGACTTTTTGCGCCATATTGAACGAACAAAGGTATAAATTAGTGT
CAAGTGCTCTGTGAGGGTACTAATGGGTGTGATGCACAAATCGTAGATTTTGATGTATGTGCTTGATACAGCAGGTTCTGAAGGACGAGATCCTTTAGTT
GATTTCAACCACTTACAACGAGAGCTGGAGCTGTACGCTCCTGGAATTTCCTCGCGGCCTTCTCTTATCGTTGCGAACAAGATGGATGAGCAAGGAAAGT
TTGGAAGTGTCCTCTTCGATTGTTAGCTCTAGTAACACTGTGGTGCTGTGTAACAGGCGCTGAAAATAATGTTCACAGGCTGCGACAATCAACCGATCTC
GCTGTACTTCCAGTCAGGTCAGTGCTGAACGATTGCCATGATTCAAAAGCGTGAATTCTAAGTTTTTACCTTGGCTTACAGCGCATTGCATAGAGTCGAT
ATTGATACGGTAGCGCGCACACTTCGATGGATGATTGAGAACGATAGCTAG