Description :
From Genome Similarity Track
Location :
Scaffold_23:1084095- 1086800
Sequence
2705 bases(100 bases per row)
AAGCCCCACGTGTTTGGTATCAGACACTATCGCTGATTTCAGCTCGCGAACGACGGCTGGTGTTGGTGCAACAATGAGAAGGTCATCAACATACATTGCG
ATGTAGCAAGTAGCATTGTCGCACGTACGACAGAGAACGCAGCGGTCTTTGATGAGCTTGTGAAACTCAAGACTTTCAAGGAAGGCCCCAAAAGAACAGG
TTCTCCATGACCGATTCAGGGGAGGTGACGTACTTACTCGGATGGTCTATTCGACGGGACCGAAAGAACTGAAAGATCTTTATCCACCAACGCAAGTACG
CTACGAAGGTCCATGACCGCTTCAGCAAATACATTCCGTACCCGATTGCAACCCCAGCAGAGAGGAACTTTAAACTTTCCTCAAGCAGTCAGCATAGCAA
TGATGCAGAGAAAGATGCGATGAAAGACATTCCGTATCGTGAAGCAGTTGGTAGTGTTATGTACCTTATGGTAGGCACCAGTTAAGAAAATGGCATTCTA
TCTACATGAGGTTAGCCAATTCCTAGCTAAATCAGGAATGGAGCACTGGAGCGCTGTCGTTCGACGTCTCAAGTGTCTCTCAGGTACAAATAACTACGGA
CTTCTTCTTGGTGGATCAACTGATATCACACCAAAGAAAATAGCTTGACAGCGTACTGTGACTCTGACTACGCTAACTGACCCGACACGAGACGATCTGG
CGGTGAATACGTCACTATGCTAGCAAATAGTCTAATCTCATGGCTCTCACGCAAACACCACACTGTGGTACTTTCAACAACAGAGGCAGAATACATCGCC
CTTTGTTACTGCATGCAAGAGATGATATTCCTCAAACTGCTCCTCAAAGCGCTAGGCTTTGTTACTGCATGCAAGAGATGATATTCATCAAACTGCTCCT
CAAAGAGCTAGGCTTTGCCACAACCAAAGCAAACACTATTCATGAGGACAATCAGAGCTGCATCAAGATCTGTTACAATCCAGAGCTGCATGGGAAATCA
AAACACGTACACACCCGATATTGTTTTGTACAAGAAAAGGTAGAGCGACACGAATTCACCGTCGACTATTGCAACACAAGCTAAATGGTTGCTGACATCA
AAAAATTGCTGGGAAAGTTCATTATTCATAAGGCAAACCGCAGAAATCCCTACCAACGCCTACCACCTACTTCTTAGTGAAGACGATAACCGGACGAACG
AAGGACACGAAGTTGATCCGGGTAGCTTGATCCGGAATCATAACGCCGTCGTCATCAAACAAGAGTCGTTTCGCACCTTGTACATGTAGCACGAATGCAT
GACCAGTGAATGAGTCATTGTAGGCCGCACAGAGGTAGAATCCATTGCGAAGCTCCAATTCCTCAAACACACGAGATCCGCGTCAACCACCTAGTACGAA
ATTGTTCTTTACGAGGGCCTTGAAGATGACGTCACGACGCGCACCACGAAGATCACGCAGAAACTTGAGAAAGATCGCCCACGATGTACCTTGAGACAGG
TCAAGTCCATACTGGTTGCGCAACTTCTCAACGAAGTCGTCAATGTCCTTCTGGGTAGCAATGTCCGGTCGTCCAGCCAGCTCCGCCACTTGTACAATCG
CCTTGAACATGCACAATCCAGATGTGTCTGCACCGATCGTGTGCTTACCAAACTCGTCTTGCTTGCAGAGCTTGTCAAACTCGCTGACGTCCGAGTCTTT
CCACCTGTCGACGAGAGCAATCTCCTCCTCGAAGCTATCCTCCAGCAGCGGCTGTCTTAGCTCCCACGTGCGCTGGTAATACCGGCGGTTATGGCGGTGA
TACACCACCCACAAGACGCGATACTCGAAGCCCAACTTGCTTTCGCGCCTGTTGATAAGTCTGGCAATCTACCAAGTTTGCTTTGTCGTGGCAAACTTGT
CACCAACTGTGACTCGGGATGGACTATAGTACTCACCGTAGATACGGAAGTACAGCTCGTAGGTGTCGGTCGTAGCAGTGCCTTGATCTGTCGCAGTAGC
GGCTTGGCCAGGTTCAGTATCAGCTTGATCTGTCGCATTATCCGTTTGGTCTGTAGCAGTAGCTTGCTCTTCAACCTCACGGTCTGGCGATTCGGGTGCG
AAATCATCCTGCAGAACTCTACAGCTCCTGCACACGCGAGCGGCAGTCCTGTTGCCTACCGTACACAAGCGGCAAAACCAGGCCTGGTAGTCCTGCTCGG
TAGCAGTTGCCGCTAGCACATCAAGTGCTGTTGCCGGATTGGAAGTGGGTACATCACTGTCACTAAATTCACTCACATAAGAAGCATTTTGTATGGCTGC
AGCCATTTCATTACATTACCCCTCTTTAGTGACATTGGATACGCGTGCAGCGTCGGCGCGTGCTGCATCTTCGTCAGCCACGCCGCTGCCGCCGCGCGCC
TTGTCGCTGCGGGGGTCCCTGGCGCTTTCTCCCGTCGATGTCCTCGCCGCCGAGTCCGCTGAACCGCTTGCCGCCAGCGCTGCACGCCGTCGCGCCTTTG
CACGCTTTCGCGCTCGAGCTTTGGCAGCCGTGGGCCGCTTTCTCTTCCCCGAAGCGGATGGCCCTGCCCGTCCGTGTCCGCCGAAGTCGCTTGACCGTCA
ACCATTGCCTGCACTAGAGCCCATGCCTTCCAAGACGAGCGTCCGCCGCAAGGTCAAGACAGGGCAACAACTAGCGCTTCCTTGGCGAACTTCGTTTTGA
TTGAT