Description :
From Genome Similarity Track
Location :
Scaffold_123:108374- 112669
Sequence
4295 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTCTGTCTACTTCTCGAGCTCTTGGGACTGCGA
TATTCAATGCTTTGTGAGAGTCAACACCAAGGAGGTGGTCGTGACTGCCCTTGCCGCCTTCAACTCGAGCCCACTCTCTTGTCCAGTACAAAGTCAACTC
TCTGCACGCCGACATAGCCAACAGCGCCCGGTGTAACGGAAACGACGGCGATAGTGACGTGCGAGGACGTGAGAGCCTTGGCATGCGAAGACGTGAGTGG
TGACGTGACCCGCAGTGTGGCTGAACGCGGTGGCTACGCTGTGTCATCTGGCTGTACGAGTGGGGCGAGGCACGGGATCAAGCAAGCAGACAACCGAGAC
GTCCGAGGAGACGGAGACGTTTTGTCGAGAGTACCACTACAGAAATGGCCACCGAGATGACCACGACGGAGGAAACGGAAACGACGGAGACAGTGACGAG
CGAGGACGTGAGAGCCTTGGCACGCGAAGACGTGAGTGGCGACGTGACCCGCAGTGTGGCTGAACGCGGTGGCTACGCTGTGTCATCTGGCTGTACGAGT
GGGGCGGGCACGGGATCGAGCAAGCAGACAACCGAGACGTCCGAGGAGACGGAGACGTTTTGGCGAGGGTACTACTACGGAAATGGCCACCGAGATGACC
ACGACGGAGGAAACGGAAACGACGGAGACAGTGACGAGCGAGGACGTGAGAGCCTTGGCACGCGAAGACGTGAGTGGCGACGTGACCCGCAGTGTGGCTG
AACGCGGTGGCTACGCTGTGTCATCTGGCTGTACGAGTGGGGCGGGCACGGGATCGAGCAAGCAGACAACCGAGACGTCCGAGGAGACGGAGACGTTTTG
GCGAGGGTACCACTACGGAAATGGCCACCGAGATGACCACGACGGAGGAAACGGAAACGACGGAGACAGTGACGAGCGAGGACGTGAGAGCCTTGGCACG
CGAAGACGTGAGTGGCGACGTGACCCGCAGTGTGGCTGAACGCGGTGGCTACGCTGTGTCATCTGGCTGTACGAGTGGGGCGGGCACGGGATCGAGCAAG
CAGACAACCGAGACGTCCGAGGAGACGGAGACGTTTTGTCGAGGGCACCACTACGGAAATGGCCACCGAGATGACCACGACGGAGGAAACGGAAACGACA
AAGACAGTGACGAGCGAGGACGTGAGAGCCTTTGCACGCGAAGACGTGAGTGGTGACGTGACCCGCAGTGTGGCTGAGCGCGGTGGCTACGCTGTGTCAT
TTGGCTGTACGAGTGGGGCGGGCACGGGATCGAGCAAGCAGACAGCCGAGACGTCCGAGGAGACGGAGACGTTTTGTCGAGGGCACCACTACGGAAATGG
CCACCGAGATGACCACGACGGAGAAAACGGAAACGACGGAGACAGTGACGAGCGAGGACGTGAGAGCCTTGGCACGCGAAGACGTGAGTGGTGACGTGAC
CCGCAGTGTGGCGGAGCGCGGTGGCTACGCTGTGTCATCTGGCTGTACGAGTGGCGCGGGCACGGGATCGAGCAAGCAGACAACCGAGACGTCCGAGGAG
AAGGAGACGTTTTGTCGAGGGTACCACTACGGAAATGGCCACCGAGATGACCACGACGGAGGAAACGGAAACGACAAAGACAGTGACGAGCGAGGACGTG
AGAGCCTTGGCACGCGAAGACGTGAGTGGTGACGTGACCCGCAGTGTGGCGGAGCGCGGTGGCTACGCTGTGTCATCTGGCTGTACGAGTGGCGCGGGCA
CGGGATCGAGCAAGCAGACAACCGAGACGTCCGAGGAGACGGAGACGTTTGTCGAGGGTACCACTACGGAAATGGCCACCGAGATGACCACGACGGAGGA
AACGGAAACGACAAAGACAGTGACGAGCGAGGACGTGAGAGCCTTGGCACGCGAAGACGTGAGTGGCGAAGTGGCTCGCAATATAAAAGAAAACAATAGC
TAACGCTGTATCATCTGGCTGTACGAGTGGGGCGGGCACGGGATCGAGCAAGCAGACAACCGAGACGTCCGAGGAGACGGAGACGTTTTGTCGAGGGTAC
CACTACGGAAATGGCCACCGAGATGACCACGACGGAGGAAACGGAAACGACAAAGACAGTGACGAGCGAGGACGTGAGAGCCTTGGCACGCGAAGACGTG
AGTGGTGAACGTGGTGGCTACGCTGTGTCATCTGGCTGTACGAGTGGCGCGGGCACGGGATCGAGCAAGCCAGACAACCGAGACGTCCGAGGAGACGGAG
ACGTTTTGATCGAGGGTAACCACTACGGAAATGTCCACCGAGATGACCACGACGGAGGAAACGAAAAACGACGGAGACAGTGACGAGCGAGGACGTGAGA
GCCTTGGCACGCGAAGACGTGAGTGGCGACGTGACCCGCAGTGTGGCTGAACGCGGTGTCTACGCTGTGTCATCTGGCTGTACGAGTGGCGCGGGCACGG
GATCGAGCAAGCCGACAACCGAGACGTCCGAGGAGACGGAGACGTTTTGTCGAGGGTGACCAGCTAACCGGAAATCGCCACCGACAGAGACGAGCGCGAC
GTGAGGAACCTTGCAAGAGACGACGGAGACAGTGACGAGCGAGGACGTGAGAGCCTTGGCACGCGAAGTACGTGAGTGGCGACGTGGCCCGCAGTGTGGC
TGAACGCGGTGGCTACGCTGTGTCATCTGGCTGTACGAGTGGCGCGGGCACGGGATCGAGCAAAGCAGACAACCGATGACGTCCGAGGGAGACGGAAGAC
GTTTTGTCGAGGGTACCACTACGGAAAATGGCCACCGAGATGACCCCGACGGAGGAAACGGAAAACGACGGAGACAGTGACGAGCGAGGACGTGAGAGCC
TTGGCACGCGAAGACGTGAGTGGCGACGTGGACCCGCAGTGTGGCTGAACGCGGTGGGCTACGCTGTGTCATCTGGCTGTACGAGTGGGGCGACACGGGG
ATCCGAGCAAGCAGTCCAACCGATGACGTCCGAGGGAGACGGAAGACGTTTTGTCGAGGGTACCACTACGGAAAATGGCCACCGAGATGACCACGACGGA
GGAAACGGAAACGACAGAGACAGTGACGAGCGAGGACGTGAGAGCCTTGGCACGCGAAGACGTGAGTGGCGACGTGACCCGCAGTGTGGCTGAACGCGGT
GGCTACGCTGTGTCATTTGGCTGTACGAGTAGAGCGGGCACGGGATCGAGCAAGCAGACAACCGAGACGTCCGAGGAGACGGAGACGTTTTGGCGAGGGT
ACTACTACGGAAATGGCCACCGAGATGACCACGACGGAGGAAACGGAAACGACGGAGACAGTGACGAGCGAGGACGTGAGAGCCTTGGCACGCGAAGACG
TGAGTGGCGACGTGACCCGCAGTGTGGCTGAACGCGGTGGCTACGCTGTGTCATTTGGCTGTACGAGTGGGGCGGGCACGGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGAGCACGTCTACCAGGA
ATGAAGGCGGCCTCTTGGACCGAACGGAGCCACGGGGAGCATCCCTGGCAGTGATGTGTTAGGGGGAGCGGGGATCAAGACAGGTCTCGGGGATCCGCCA
CCATGAGGCGATCCTGGGGAACCGCCACCATGAGGCGATCCTGGAGATCTACCACCACGAGGTGACCCCCCTCCACCAGATCCGGGGGATCCGCT