Description :
From Genome Similarity Track
Location :
Scaffold_477:10831- 14131
Sequence
3300 bases(100 bases per row)
ACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTCGTAGTCAATCCACGCCACCGCGGGTAGACTACCTGAACCTCTCCGAAGT
TCGTTGCCATGGATAGGAACGACTTCTCCCATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGGGATGGAGGCCCTGCAGAG
CCTGGTGGCGTCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTCGACGCGTACGAGCAGGGCCTCATCGCGCATGTGCGGGAGAACCTGCAGGCT
CCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGGTTAAGCCGTATGAAAGGAAGGAAGGCGAGAACCTTCACTTCTGGGCCCGAG
AAGTAGAGCTCGCGATGGACGTGGATCTGATCTCGACCGAGCAACTTCGTGTTGCTTTTGCACTATCCAACCTTAGCGGTCGTGCTAAGAGTTGGGTGTA
CACTCGGGAAGCAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGCGTTCCTCCCGGCGAACTACGAGTACCGCCAG
CGTTCGCGCTTCCTCGCGTGTAAACAAGGAAGGCGCGAACTGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGCGTCCCTAGTGGGAAACCCACTCA
ACGAACACATCAAGATGACTGTGCTCATGAACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGTTCCGGGTGCAGTCAAGCACCCTTGAAGAGGCGAT
TCAAGTGGCTCTTCAAGAAGAGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCGTGGCCTGGGAGATCCTTGTCGGCTCCCGGTCGAACAAGCCCC
AACGGACCAGTTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGTGGGAAGATGGGCCACTTCAAGCGTGACTGCCCCGCGG
AAAGACTTCGCAGGCGGGCTTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCATGATCCCGGGGACAGGGGAACACCGGAAACCAGTAGGGGCG
GGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGTACCACGGGGACTTGGCCCCTGAGAGTCTTTGCACTCTCGAATCGG
CGAAGAGCAGCGGCGGGTTGCTCGTAATACACGGATGTGTACGGGGATACGATCACCCTTTTAGAATATTAATCGATTCTGGGGCGTCGAAGAATTTCGC
ACACCGCCAGACGGTTGCTCGTAATAGCAACAAATTGTCCGATACTTTGAGAGAAAGCAAGGGCAATGGGATGGTGTCAGTGCGACTGGCCGACAGGAAG
GTCGTCACTGTCCCCAACGTCCAAGTGGATCTGGCCGTTAAGTTTGAAGACTTTGACAGCCTCGAACAGTTTACTTTTCTCGACATGGATCCCTACGATA
TGATCTTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGGGCCGACAGGCGAGGCAAGGCAATCGGTGCCAGTCGCCCTGCGCAGTCCGACAGAGCATT
GGTGAGTCATGTTCTTACCTCTGTCAGGCCCCGGGGCGCCCGCAAGGGTTGCCAGGGTACGAAAGCATCCGGCAGATGCTTAGGAGTCGTCGACGTATAT
GACGACTCCGAGGATGTTTTGATGGTGGCAGCACCCAGAAGAGGCGCTGGCCAAGTGGGTAACTTAGGTCCACAGGCGGGTAACTTAGTTCCGCAGACAG
CTGCAGCTGTCATGAACACTGAGAACAGCGTGTTCAGAGTGGGTAACAAAGTTCCACTCACGGTCGCCCAGACCTTAACTGAAGAGGAAGACGTCGGATA
CGCTTCCTGTGTGGGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTCGAACACGCTCCTGTGTGGGTTCCATAGTACCAC
ACGAGGCCACGAGTGCCTCGGATGTCGTAGCGACGGCATCCCTAGACGTGGGCAGCAAAGCTCCCCGTCACAGACGCCGTCGACAAAGACGCCGCCGCCG
CCTCAAGTCGGATCCGAACTTCGTTCCGATCGACGTCGCTTCAAGCGACTCGGAGTTTAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGTTAT
CACATCTTCGATGGCGAGACAGGTTTACCCGTCAAGGCATCTGGTGTCCACTTGGAACCGCTGCCAGAGGTTGCAGAGATACTGAACCTCGAGAAAATGA
CGGTTGAGGCTTTCCTGGCCAGCCTCAAGGCTGGAGAGATTGCTGAGATGGTGCTCATGAGACCTGAGACCACTCGGGAGGAGCTGAACTCCTCCTCTGT
CTTGGACGAGAACGTCCTGGAAGACCTAAACAAGCAGCGTCAGACCCCGCTTGGCTACTGAGATACTTAAGAACCCCAAGGATCAGGTGTATCCTTTGGT
GACGGAGTATGCGGACGTGGTGAACAAACACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCACGAGATGGATCTCGTGCCCGGCACGAGATGG
ATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGTGCGAACAGTGCGAGGTCATTGATGACTTCTTCGCCACGAAAGCGAAGGA
AGGCATGGTGCGGGAATCGAAATCCCCGCGCTCGACGCCGCCTTTCTGCATTCGGAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTG
AACAACGCAACGGTGCCGGCCCAAACATCAATCCGACGAAAGGATGTGTTGCTGAACAACATGGCCGGGAGGGTACCGTACAGCGCGCTGGATTTGGTAG
ACGGATACTACCAAATCCTGATGCGAGAGAGCGACATCCCGCTCACCGCGGTAACTACTTCAAGCGGCATGATTTGGGAGTGGCTAGTCATGCCGCAGGG
CTTGTCTAACGCCCCGGCGACGTTCAATCGTCTGATGACGCAACTTTTCGGCCCTTTGCGTACCTTCGTACAGAGGTACTTCGACGACATATTCGTCCAT
AGCCGTTCCGAAGGAGGCAAGACGGCCATGGAGGTGCATCTAGGACACCTCCGTCGAGTGTTGGACGTAATGCGAGCGAACAAGCTCTGCGCCAACATCG
ACAAGTGCGTTTTCGCGTCACCAGAGATTAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGAGCTGACCCAGACAAGGTCAAGGCCATAGCAGC