Description :
From Genome Similarity Track
Location :
Scaffold_21:108303- 110057
Transcript NameFunction/comments
Phyke_g1379hypothetical protein PHYSODRAFT_309039

Sequence
1754 bases(100 bases per row)
CCAATATTGATAGCAGTCTCCTCCTTGTCACCAGTGAGCACCCAGATCTTTATACCTGCACATGCCAAGTTAGCGATCGTATCCGGAACACCTGACTGCA
GTTTGTCTTCGATCGCTGTAGCAccgagcagctccagattGCATTCGATCTCATTCATGCATTGGTCGATGACATTTGGCTGATCTTTTTTGCGCTTGTC
AATCTCGGCAAGGTTGTTCTGTGCGTCATGGAAGCGTGTTGACCAGTCTGCATAGTACGATGGTTTGATCTCGCGCACTGCGATCGTCAGAGTGCGTAAC
CCGTCCTCGGCATAATTGTCAACATGACGTCGAGTGATGTCTTGGAGCTGCGAAGAGGTAGTGTCACCTTCTCTATCCTTTGCCAGCAATCCGAAGATAA
TCACGTCTGCACCTTTCGAGTACAAGAAAATCCGGCCATCTGGGTGGCGAATGATCGTACTCATGCGCTTCCGCGTGCTGTTGAATTCCAGAACATCCAG
GATCTCATACTTATGGGGAACGCCACGAACTTTAACGTGCGCGATACCCGGGGATCGATTCACGAATTCATACCCGAAGTAACCGGCGCCAGCCACCAGT
GCCTGCTCGtctggagatgaagctgaaagTGTGATTTCTGTCGAGTTTTCATGACGTTCGGGAATGACTGTGTGGCATACCGCAAGGTGTGTGAAGAAAG
CGTCAATCCGTCGCTGTTGTACAGAACCTGAGTCGCCTTTCATATCGTTGAACAATTCTGGGCCGTCAAAATTCACGTACGGCACTTTTGGTCCCGATGA
GTGCGATGTCATGTCCGGTATCGGTTTTCCAGCACGCTTGAGTGCTGCCAACCCAATCTCCGTGGTCCCGTTGCCGTAAGAAACACCGCCGATAGAGCAT
TTCCGGAACTCCATGACATTGCACGTCAGTGTGCCGGTTTTGTCTGAAAATATGTACGAGATCTGCCCAAGCTCTTCATTGAGCGACATGGAGCGTACCA
GAGCTGGTGTGTCGGTGTCCGAGTGGTAAATTTTAATGTCCCACTGAATGAACTGCGCTTGGAGATACTTAACCATACTCATGGAGACCGCGAGCGAAAT
GGGCACGAATTGATACATGAGCAGAAGATAGTAAAACAACATGATGATCCAATCCACAAAGGCGCTGTTGTCGGATACGCCCAATTGGAGGTACCACACA
CTGTCATTGTTTGTTTTCCAGGCGACTGCTCCCGTTGCCCCCGCAGCGCTGAAAAGGAGTAAAATCGACAACAAGACCGCCGTGTACTTGTTGATGGAAT
GATCCATGGAGCTCATTTTGGACGGAGGTGCCGAATTGCTCATCATGATTTTCGTGTCTTTGCCGGTATTGAAAACCACACCGTGGACCCAATCGGTATT
ACGAATGGTACAACCTCGGAGGATGATACTTTCGTATGGGATAGAAGCTTTTTCTTTGCCTTGGAGCTCCAAAATACCTTGGAAACTGTTTATGGCATTA
TTGGGCTGTTCACATCGGATGATGCCTTTCATTTGGAGCAAGTTGTCGATGGACCCCATTTCTGCAAGAGTGCATTCCATTGCTGAGCGAACTTTCATGT
TGGTTTCTCCATCCAAAGACTTTGTCTCAACATAGCAGATACCACACGGAGGTTGGTTAGGTATTTCACTCACTGCAACGACCAGGATGTCGGCTGGAAC
AAGACCGCGGTTAGTGACTTTGACAACGTCCCCCACTGCAACGTCTGCCCACGT