Description :
From Genome Similarity Track
Location :
Scaffold_129:108302- 110519
Transcript NameFunction/comments
Physo_109538hypothetical protein
Physo_143113hypothetical protein

Sequence
2217 bases(100 bases per row)
CCAGCGTTCGATTCATACGTTTCGTTTGCCCGTCGCCTTGAGCTCGGTGAGTCACGGTCATGCTCAGCTTCGTCCAGATTGACTTGAAGACGTGTTGCCA
GAAGGCGGACACGAACTTCCTGTCGCGGTCGGAGACAATGTTCGTCGGCATGCTGTGGAGCTTCCAAATGTTGTCGATGAGGAGTCGAGCCACGCCTTCC
GCCGTCACCTTCTTCGTAGTTGGCACAAAATGGCAACGTTTCGTCAACCGATCGACGACAACCCAGATGGAGTCGACGTCTCGCTTCATTCGCGGGAGAT
CCGTGATGAAGTCCATGGAGATCGACCCCCACCGTTCATCTGGGATGCTTAGTGGCTCAAGCCAACCAGGAGGCTTCGTTAACCGAGGCTTGTTTCTTCG
ACAGGGCTTGCAGCCTACGATAAACTTCTGGATGGACTTCAGAATCTTCGACCAGTACCAGCGGCGCGCTAGTGTCAAGTATGTTCGCTCAGCATCAGGA
TGGCCGCCGTAGTTGGTGTCATGACACTCACTGATGATTGTCTGCCGCAACTTTACATCGTTGGGCACGACAACGCGCGGAGCATCGTCTGCGGGTGTTT
GATACCAGAGCAGTCCATTCGCTTCGGTGTAGCATCGGTACTTCTTCTGCTGGTTGCGTTCACGCTTTGGTTTCGAGCTGGAGTTGCGCCGCTTGATCGC
TGTGAAAATGGCCTGGACCTCGCGGGCTTTCTCATACGACTTGTTGATGCTTGATATCAAGTCGGAGTCGCCAGTTACTTCGCTGATCGCCAGACTGAAG
GATGTATCGTCGAAGCTTGTCACACTCAAGTCGTGGAAGAACTTCGTCTCCGGTTCCAGGTCTGGTCTTGGGCTCAAAGCGTCTGCAATACCTTCTTCGC
TCCAGGGAGATACGAGAACGTCGGTTGATACTCCGCAAGGATATCATACCAGCGTGCTAGTCGGCGGTTGGCCATCTTCTGTGTGAACAGGCCTTCGAGA
CTCTTGTGATCGGTCTTCATAATTGGCGGCTTGTCCAAGCAGTAGATCCGAAACGCGGCCAGTGCATGAACGATAGCTAACAACTCCTGTTGTTGCGTTG
GGTAGTTGAGCTCCGCAGACTTCATCTTCCGACTGGTGTACGCAATGGGACGCTCGACACCATCGACGACTTGAAACAGCACTCCACCTACGGCGAACTT
GCTCGCGTCCGTCCGCAGATGCATTGGCTGGCTGAAGTCCGGGAGATGCAGCACTGGTGGGTTGCACAACCTCCGCTTCAATTCCTTAAAGTTCCTCAAC
TGCACGTCGCTGAAGTGAATCTTCGCATTGCGCTTGGTCTTCTTCTTCAGGAGGGCGAACATGGTTGCCGTGAGCGAAGCGTATTCCGGGCAAAAGCGTT
GCACGTAGCCAGTCGGACCCAGGAAGCTGTGAAGCTCCTCTTGGGTCCGCGGCACGGGCCAGTCTTTGATGGTTTGCACCTTGTCGGGGTCCATCCGAAC
TCCGTTACGTCCCACGAAATCACCAAGGCATGGAATCTTGTCGGCGCAGAAGACACACTTGGACAGTTTGACGTACAGCTTGTTGTCGCGCAAGATATCC
AACGTCTTGCGCAGCGCCTCCAAATGGTCTTCGATCTTCGGCGACTTGGTGAAGATGTAGATGTCATCGTAGAACGATTTCGTGTTCTTCAAGTCTCGGA
ACAGCTTCGAAGTCAACCGGTGCATTGTTGCTGGCGCGTTGCAGACTCCCATCAGAAGTACAAGATACTCCCACAGTCCGTTTGGCGCCTGGAAAGCTGT
GAACTTGATGTCTCCCTCCCGCATACGCACTTGGTAATACGCGGACATCAGATCCATAGTGGAGAACCAGTACGCTCCAGACATGGCGTCCAAGATGCCT
TCCATCCTCGTCATCGGGATGCTCTGGCGCACAGTGTTTGAATTGAGATACCGGTAGTCGTGAACGATTCTACAGCCGACTGGTTTCCGGACACAGAATG
TCGGCTCTGCGTGAGGACTGATGCTTGGTCGGATGAGCTTCTTCTTCACCATGTCTTCGACCCAACGCACGATCTGACGCTGATGCTCAGGAGACTGTCG
CCACTGTTGTCGGTACATCGCCAGATTTGAATCCTTCACATCGATCCGATGCTCAATGTCGCGCTTCTCTGGTAAACCTTCGGGTAGCTCAGGACGGAAC
ACGTTGTCCTTGTACTC