Description :
From Genome Similarity Track
Location :
Scaffold_74:108286- 110529
Transcript NameFunction/comments
Phyca_LT1534511073DNA replication licensing factor MCM5 putative
Phyca_LT1534537122Hypothetical protein

Sequence
2243 bases(100 bases per row)
agttacttgacgcgggacacgaacttgtactggctcagttggcgtagcgagcccttctgcaccatggctcgaattgcacgttgaatagcgttgggattgt
atccctgagcctccagcctgctgtacaatgcacttgtctcgacacgcgtgccgatgcgtaaggtgcgattgatactctgctccacctcctgagccttctc
atgaaagcccccaaatagtccctgggtacctccatccttcgcggcattcatcgtactcacactgaacagccgaatcgcttcctgtacgtgttcgcgggtg
gcttcattgagcagatgcatcttcgccaatgactcggaaatacgcaccagagcctccagctgacgcacagtaacaggaatcgttgtttcgccaccttgag
tacgccgcacatcgtcgcgaacgccaacataaaagtcctgtagtgcctgtgcagctccaaccgaaagtctcggcgcgcatcgcgtacggcagtatgtgat
gaacttcttgagcagccacggctcgaattctcctccactcgaagcgctttcactagctgaaggcttgccagcagctgacgcgagtgcgttcgtatgcatc
cggacaacgtgagcagccatttgtctgtctctggcatcgtcctggatgtcacgcacaatgaaaatcatgtcgaatcgactgagaatggtgctcatcagat
cgatattctccgaagctgagcgcatatcatcgtagcgaccgaacacggggttagcagccgccagaacacttgcacgcgagttcaaaatggtggtgatacc
agccttggcgatggaaatggtctgttgctccatagcttcgtgaatggctacacgatccgattctcgcattttatcaaactcatcgatgcacaccactcca
ccatcagccaacaccatggcacctccttcgagataaaactcgcccttggaatcgcgaataactgaagctgtgagaccagcagcactactgcctttaccgg
acgtatacacccccacaggtgcgattttctctgtaaatttcaagaactgggactttgccgtactgggatctcccaacagcaggacgttaatatcaccacg
taagatcattccatcgggcagtctctttctcgatccaccagccagtaaacaagcaatcgccttcttcatgttcactgtgtagtcaccgtaaatggacgga
gcgatactagtcgccaatttctcgtacaaattcggatctcgagccatttcatggaatttttcctcttcagcaggcgaaaaagtggctttagcacgtcctg
caccttcttcgtcgatctcaatacccaccacacgcaagtacagagtgcgaatggctacagctccgacgtttcgacctccagcattgacaactgaagtgat
gccgaccaccgaaactcgtgtgccgggggatgctctgtccaccaagtgacgatccgcaatcagagccaagttacgtggcatttcaccagtcggtaccact
tccgggttctcctgcaacttaagcgtctgttgatccacatactctcctttatctggcaggaccatatatgaatctttcggacaaagatctccaggggcag
ggttctcttcttcccggttgcgatcacagacacgagggatgctcacaccccccattccggaaacggcaacgcgcttagtatggccacagttgcggcatcg
taaagttgccgatacacacttggtgcgcactcgagtggcactgatgacaattccgggtactttcactagccgattgatttcctgggcgtgaacatggcga
agagccactggggcttggtcactggtaagtatggcttgaatgtccggcaaatttgccgcgcgaagagctgcgttatcagacgtagccgcatcggcaactg
cctcttgcccttgcgtgctgaccacgagcagttgcgccaacatttcctttgccgcattctccagtaaaggcaattgttctttcgggttcttcaacagaag
atcttgcagttcctgatcgaaggcggcaacatgcgagaggttcacagtcacgacccagtggtggcggcgggcgttggccagtagctgttcgcggtagtag
aaaagcgggcccacacggaacccgcgcaggaaggccaggagacgtcgctgcaaggctgccggactcgcactttgccttgcatccgacgcctgcgcgctct
ccatgcccacggccgacacgcgacccgcatcccagtccattgt