Description :
From Genome Similarity Track
Location :
Scaffold_410:10828- 16135
Transcript NameFunction/comments
Phyag_g5471ABC transporter lipid exporter ABCA1 family

Sequence
5307 bases(100 bases per row)
GCTCACGTCCTGCCTCtccaccatcgtcaccaacgaCTACAGCTACGCAGTGTGCGTCATGAACTCGGGCTTCTTCGAACTCGACTCGTCACCCTTCGGC
CAGgccacgtccacgtccaTCTCCTCCTTACTCTCAGGCTCCAGtggctccagctccacgaccgtCGACGCCACTGGCACCTGCTCCCTCACATGCACCA
AGCCGGCCATGTcagcgtccagctcctgctgttcTGCGGCGAAAACTGTGCTCAACTGTCCCCAGTCCTCGTCCAATATCTCCTACTGTAAATCGGTCAT
TGAGGACACGGTGGCGGACAGTCAGCAGTGTGGACTGTCGGCCCAGAACACAGCTTTAATCGTCTGTGTAGCCATAATTGCAGCCTTCTTCGTTgcggtg
gcagtggcagccAGGATTTACGCCAAGAAACAAGCAACAGGGGCAGACGCACTCGAGTCCAGGCTCGCCGTGGCGAGTAAAGTCAAGTGGGAGGCAGTTT
TAGCTGCCTGGAGACAAGTGACGAACTTGATCTGGAAGAATCTCATCATCCGACGACGTAAACCCGTGTCTTTTGTGTTTGAACTCTTTCTTCCGGTCGT
GTTGACCCTCGCGCTGGTGTTCATCGCCAACTTGGACAAGATTTTTGGTACCGGAGATAATTATTCCAGCTCTTCTGAAGCAGCGACGTTGTCCGAGACC
ATTTTGTGTACGGGGTTGGACTCGTTGGCGTTTACGGACTACGGAGCGTTGAGTACCAACATGTCGACGTTCTACAGCAGCGGACAGAGTGTGATCGGAC
TCTTTTTGCTGATTAGTTACATCAAGTTTGtgtccacgaccacgacgacgatggtgatcgagaaggagacgaggaTCCGGGAGGTTATGAAGATCATGGG
CCTGTCGAACTTTACGCTGCTGTGCTCGTGGTGTCTGACGACGGCCATCTTGGCCACGCCGCTGGCGTTTGTTATTGCGGCGGAATTGAAATACGGCCAG
GTGTTCCCCATGACGGAGTACGCGACGCTGGTGTTCTTGTTCTGGGCGCTGAGCTTGTCGATCGTGAGCTTCAGCTACTTCATCACGCCGTTTTTCAACA
AGTCGAGGGCTGCGTCAATCGCTTCAGTGCTGTTGTGGCTAGTGCTGTTCTTCCcgttcttctccgtcatgtcCAAGTCCAACTCGCAGAAGTACCTGGG
TGCGCTTGCACCTCCGACTGCCTTTGCGTTGGGTATTGACGACTTAGTACGTCGTGCTCAACTTGGTAGGGGGCTGGCGTATGCGATGGGGATGGTGGAA
TCTCCCGTCACGGTTCCCTCGGCGTTCAAAATGAGCTGGTTTTTGATCCTGGACTCATTCattctcgtcgttctcggcTGGTACTTCGACAATGTTCTCC
CACAAGAGTTTGGCGTCCGTAAGCCGTGGAACTTTCTCTTCGTGAAGGATTATTGGTTTCCAGGGAACACAACCCACGACAAAGAAGTATTGGTGTTGGA
ATCTCCCAGCACAGCTTCCTCGCCTCAGACCAACTATTCATTTGCATCACCACGGGGCGGGgcgcggctgctgcatcagtCTTCGTCCGACGGATCTATT
GTGATGATGAAGGACCGACCTGGCCTTGTGGCTTCTGTGGAGCCCGTTAATGCCACACTCGCAGCCCAGGAACGTAAGGGGACGTGCCTGCAGATTCAAG
GCCTGCGCAAGGAATTCCCCtcagacgacggcgaggtgaAGGTAGCAGTGCATGGGCTGAACCTTACTCTGTACGCCGGACAGATTTCCGCGCTGCTAGG
ACACAACGGCGCAGGAAAGACGACTACGATTTCGATGCTGACGGGCCTTATCCCGCCAACTTCAGGCGATGCGACGCTATACGGCCGCTCGGTTCAGGCT
GACTTCAACGAGCTTCGCCAGATCATGGGTATCTGTCCGCAGCATGACGTGCTGTTCAACGAGTTGACTGTCGAAGAgcacttgttgttgttcGGAACGA
TGAAGCACATCCCATTCGTCAGCCTGAAGGAAGAAGTGGAGCGAATGATTCGAGAAGTTGGattggtggagaagaagaaggttgCTGCAAGGAACCTCTC
TGGTGGACAAAAGCGCAAGTTGAGCGTTGCTTTGGCGTTCATGGGGGATAGCAAGCTGGTCTTTTTGGATGAGCCTACGTCTGGCATGGATCCATACTCC
CGTCGGTTTACGtggaatttgctgcagcggAACCGTGACGACCGTGTTATCGTTCTTACTACTCACTTTATGGACGAAGCAGACATTTTGGGTGACAGGA
TTGCCATCATGGCCGATGGTCAGCTCTGTTGCGCTGGTAGCTCGCTGTTCCTGAAGAACCGGTACGGCGCTGGGTACAATTTAACCATGATTAAAGCGCC
TGGGTgcgatgttgaagcggttgGCACGTTCTTACGCAACTTCGTTCCTGAAGCGAAGTGCTTGAGTAACTTCGGTTCGGAGGTTGTGTTCCAGCTTCCA
TCGAAGTCGTCGGGGGTATTTTCGACAATGCTGCAAGTTCTCGACGATGAAATGCAGCGCTTACGCGTTGTTCAGTATGGTGTATCCGTGACAACCTTGG
AGGAAGTGTTCTTGCGCATCTCGCACGATcgcgaagaagaggctgcCTTGGGTGTAGCTGCCTGTGGTGTTGAAGCGGTGGACCAAATCCGTAAGACGTC
GGCGACTTCAGCAAATTCCCGTGGCACACTTACGAGCGCAATTTCGACCGAGACGACTAACCGTGCAACACTATGGAGCCAATACTCGGCGCTATTGACC
AAGCGTGTGCGCATCGCGAAGAgggacaagaagaacctcTTGAACGCTGTGTGCATTCCTCTGCTCTTCCTGATCATCTTAGTGTCGCTTCCGGAGATCG
ATGTGGCAAGTTTCATGACTACGAGTGACTACGCAACAGAACTGGCATCAGCATCTCGACAAGGCAGGTGCTCAAGCGCGAACTTCTCGTTGGTCTCTGT
TCCAAGTGCTTGTGATAGCTACACCTTCAATTACTGCGACCTCGGTGTGATtgactgcagcgcttcgacgtGCTGCGACAAAACAAATTACGAATCGCCT
TACTACGCATGCAATATGTGCGATGGGACTTCGTCATCCAGCCCCGTAACCCCGTGCTACAACAAGGACTGCCTCGACAAAGATGGTGCGAAGCTTCAGG
CTACTCTGAACGCCTTCTTGACGTCTGTcgtggtgatgctggcgtTCGCTTTCGTCCCAGCTGCGATTGTAGCGTTTGTTGTGAGGGAGAAGAACCCAAA
CCAGAACGCTAAAGGTCTGCAGCTGATTTGCGGTGCGAATGTGTCGGCTTACTGGCTGTCTACATGGACACATGATATCGTTATCATGATGGTTACGGTT
ATTGCCTCCATGATCATGGTGCCTTTGTCGGACCGGACGTTGACAAGTTCTATGGAGGTGTGGGGAGTCGTTTGTCTGGTTGCCTCGCATGCTCTGGCTG
TGATTCCAATGGCCTATTTGTTTTCTTTCAAGTTCAAAAAGCATGCCGTGGCTCAAACATCTTTGCTGGTATTTGCGCTCTGCACGGGTGGATTGCTGAG
CATTTTCTCGTTCTTGTGCCGactcatcgacttcgacttgaCTCCGGGCAACTCCTCCGACAACTTAACACTGTCTTCGCTCGACAGAAACTATCTACGC
TGGATTTTCCTGCTGTTCCCAGGTTACAGTCTGAACAATGGTATTTACGAGATTGCCACGAGGAAGCTGAGCCGAAGTGCACTGTACGGCAGTAGCACCG
AAACGGTAGCACCACCTTCGTTTTTTGGGGCTTGGGAAGGTCTCGGCACTGATTACACGTGCACTCCGTGCTGGGACGCAGCGAGTGGCGAGGATTGCTG
TGTGCGTAATGTCTTCGATCTCGATGTGGCTGGAGCTTCGGTGGCCTATGCTGTCATCGAGATCGTGATTTTCATGCTGTTGGTATTTATTGTTGAGAAC
CGCAGCTTGTCGTGGCGTCCGGAGCAACGGCAGCAGTGGCCTCGTAGTGAGGATGATGATGTGGCTAAGGAGCGCCAAAAAGTGGAGCGTGCGTATCCCA
CCCAGAACGACAGCGTGTTCATCCGTAACCTGCGACAGCAGTATGGGCGTAGAGGCAAAGTCGCGTTGGATGATTTGTGTCTATCAATCTCGAAGGGAGA
ATGCTTCGGCTACCTTGGCATCAACGGAGCTGGTAaatcgacgacgatgaaagtTCTGACCGGCGAGATTGCTCCTACAAATGGTTTCGTGACACTCGGC
GGGTACGACCTGTCTCGTGACCGCGATAAAGCACGCCGAGTTGTTGGTTACTGCCCTCAATTCGATTCTTTGCATGATTTGCTGACcgtggaagagcagc
ttgagctGTACGCGCGACTCAAGGGGATTCCGAGTGACCGCGTCCACAAGGCCGTGGACCAGAAAATCGAGGAAGTGGGGCTCACTGAGTACCGATCCAA
GCTGACTCAGGGCCTCAGTGGAGGCAACAAGCGGAAACTCTCGACGGCTATCGCCCTGATTGGCTCTCCTAGCATCATCTTCCTGGATGAGCCTTCAACA
GGAGTGGATCCAAGTTCGCGACGAAAAATGTGGGATGTGATTGCCAGTGTCTGTGCTGCAAAAGAGTCGTGCGTTGTGCTTACAACTCACAGTATGGAGG
AGTGTGAAGCCCTTTGCACTCGCGTGGGGATTTTGGTGAGCGGAAAGCTGAAATGTTTGGGAAGCGTTGAACACCTGAAACAGAAGTTTGGACGAGGGTA
TATCGTTGAAGTCAAGCTGCGTGAGCCAAGTACGTCCGCAGTGGgaaggctgcagctcgaagtgtATCGAATTCTAGGAGGCAACACTCCTGGTATTTCA
CAGGATCACATTATCAGTCTGTGTTCATCACTGGGAGTTCCAAACCGTGCGCACGAGATCATGAACGGTGAGGGCAACGGCAGCGTGCTCAACAGCTACC
TGGAGACGTCGGGCATCATCCCCATCGACGTCttctgctcgtggtggcACACTGAGAACATGGGCTCCTCGCTGTTGGAGTTCTTCCAGTCCAAGTTCCC
AGGCTGCCAACTGATCGAGCACCAAGGCGGCCACTTCAGGTTTCAAGTGCCGAAGCAGTCGCTGCGACCGTATGCAATTTTTGGGCTTCTAgaggagaac
aaggagcAACTGCACGTGAGCGAGTACGGCGTGAGCGAGACGTCGTTGGAGCACATTTTCAACACGATGGCTGCTCAGCAAGGCGAGGAACAATTGATGG
GCAGCGC